Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig11
Contig Information
Length 417 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem10g05   
Homology (BLAST) Top Hit AGAP007284-PA [Anopheles gambiae str. PEST] >gi|157020225|gb|EAA04315.4| AGAP007284-PA [Anopheles gambiae str. PEST]
Score 77
Evalue 3.47547
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig11
GGATGATGAAAGATTCAATAGTCGAGACCCGATTAGGTCCATGGTTGCACATAAATTATACAGTATACTAGATGTTTGATTTCATTAAGCACAACAAAGA
GGTTCTAGTCGTCTAATCATCGGCCTCGGTTTTGGACTTCTTTTTTTTCTTTTTCCCTTCTGTGGCCGTCTTAGGCTCAACAGACTCTGCAGCATCACGG
TTCTTCTTTTTCTTTTTCTTGGGAGTCTCGTCTTGCTCGCCATCGACATTGGCTGCCATCTCTTGCCTCGTGCCGAATTCGGCACGAGGTTCCCAGCTGA
GGTTGTGGTAGCAAGGCAGAGAGAGCAATGGCTTCCGGCCAGCAGGAGAGGTCGCAGCTGGACCGCAAGGCCCGCGAGGGCGAGACCGTCGNCCCCGGCG
GCACCGGCGGGAAATCC
page-top