Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig10
Contig Information
Length 721 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem11i02   
Homology (BLAST) Top Hit hypothetical protein OsI_24195 [Oryza sativa Indica Group]
Score 771
Evalue 3.22625e-80
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig10
GCAGCAATTCTCAANAACAACCGAACATAACGATGCATCACACTACGGTAGAAACATAGAAACGACCAGGACGACAGACACAGGCACCATTGGAGGACAT
ATCAAAGACACAAGACCTGTGAACCCAACCCACAGAGAAGCCGCTCCATTGCCAGGCACTTACTGGCCACCACGGAGACGGAGCACCAAGTGAAGGGTGG
ACTCCTTCTGGATGTTATAGTCCGCCAGGGTGCGGCCATCCTCAAGCTGCTTACCAGCGAAGATCAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTC
CTGGATTTTCGCCTTCACATTGTCGATGGTNNCAGAGGACTCAACCTCCAGGGTGATGGTCTTGCCGGTGAGGGTCTTGACAAAGATTTGCATGCCCCCA
CGAAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCCAGGGTGCGGCCATCCTCCAGCTGCTTGCCAGCAAAGATGAGACGTT
GCTGGTCCGGAGGGATGCCTTCCTTGTCCTGGATCTTAGCCTTCACATTGTCAATTGTGTCCGAGGACTCGACCTCAAGTGTGATGGTCTTGCCGGTGAG
GGTCNTCNCAAAAATCTGCATCCCACCCNTGAGCCTGANCNNCAGGNGAAAGGGTGGACTCCTTTCTGGATGTTATAGTCCGCCANGNTGCNGNCCATCC
TCNAGCCTGCTTACCATCANA
page-top