Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig9
Contig Information
Length 480 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem2h12   
Homology (BLAST) Top Hit hypothetical protein OsI_30240 [Oryza sativa Indica Group]
Score 246
Evalue 8.87538e-20
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig9
GAGCGTACACAAAGTACACACATACACACCCATCACTCGTCTANCATGCAGTGANCAGACCGGGATAAGAAAACGAAAGTTACNANCACTAGTANACAGT
AGTACGAAGCTCAAGACAAACCACATGCATCCTCNGACGGCAACGTACGCTATGCAGGATTAGATAACCAAAANAGCAGCAAACATGGCGGCGTCGCAGA
AGTTGTTGAGCACCCTCTCTTCTTCTTCGGCCGACGGCTCTTATTTAGCGGTGGTTGCTCCTGGTCCTGGTCTCGTCGCTGTAAAGCCAGTCGTAGACGG
TGGGGGAGTTGGGCTGCGGGCGGTCGAAGAGGTTGGCGCCGAGGCTTTTGGTGGCCAGGTTGCTCCCGGGGTGGAAAACGCTCCGCCACACGCTGCCGCC
GCGCGGGGGCGTCGACGACGACGGCGTCACCGGCGTGGTCGGGGTCGTCGGCATCCACGGCGACTGCTTAATCGCCTCCC
page-top