Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig8
Contig Information
Length 295 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem9b23   
Homology (BLAST) Top Hit caleosin 1 [Hordeum vulgare] >gi|34538475|gb|AAQ74238.1| caleosin 1 [Hordeum vulgare] (no hit)
Score 753
Evalue 3.65436e-78
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig8
GGCTCAGGGCCCCAGAGACCATGCACCAGCACCAGCGGCTGCAGCTCCAGCTCCGGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGTCT
GACATGAAGCTTTAGCTTTCTGGTATTATGAAGGGTTAGCCTGATTTTGGAGCATCTGAAGTTCATAACTGTTTTCTGTGCAATATCTGTGTGCCGCGTC
TGAGATACCTTCAATATCATATCGTGTTTGTTCTGTTGGATGTTTCAGAGATGCTTATGCAGAGTTTCTTTAAACATTTTGGTTCAAAAAAAAAA
page-top