Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig5
Contig Information
Length 726 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whem19g10   
Homology (BLAST) Top Hit putative polyubiquitin [Adonis aestivalis var. palaestina]
Score 928
Evalue 2.04835e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig5
ATGCANATCTTTGTGAAGACCCTCACTGGNAAGACCATCACCCTANAGGTTGAGAGCTCCGACACCATAGACAANGTCAAGGCCAAGATCCAGGACAAGG
AGGGCATTCCCCCGGACCANCAGCGTCTCATCTTCGCTGGCAAGCAGCTGGAGGATGGCCGTACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCT
CCACCTTGTCCTGCGTCTGCGTGGTGGCATGCAGATCTTCGTGAAGACCCTCACCGGNAAGACCATCACTCTTGAGGTGGAGAGCTCCGACACCATCGAC
AACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCTCCGGACCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTTGAGGATGGCCGTACCCTCGCTG
ACTACAACATCCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTATGCAGATTTTTGTGAAGACCCTCACCGGCAAGACCATCACCCT
TGAGGTTGAGAGCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGGAGGGCATTCCCCCGGACCAGCAGCGCCTGATCTTTGCTGGCAA
NGCAGCTGGANGATGGCCGNTACCCTCGCCGACTACAACATCCAGAAAGGANTTCCNCCCTCCACCTTGTCCTGCGCCTGCGNTGGTGGAATGCNAAATC
TTCNTGAAAACCTCNCCGGGAAAACC
page-top