Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig3
Contig Information
Length 756 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem3i13   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)] >gi|125535986|gb|EAY82474.1| hypothetical protein OsI_37691 [Oryza sativa Indica Group] >gi|125578704|gb|EAZ19850.1| hypothetical protein OsJ_034059 [Oryza sativa (japonica cultivar-group)]
Score 123
Evalue 4.83806e-05
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig3
AACTTGAACCCAACACATAGCTTGAAAAGCATGTCCGCTTCATGCAGTACACCAATTGGAAGGGAGCATAAATGAAATCGCGATCCATCTTTCCTAACCC
TTTCTCCTTCATGGCACCATCCATTCCTCAGTTTCCGTTGCTGCATGTGGAGGCACATGATGCAACATTTCCTTTCTCCTCAGAAGCTGGATCAGAGTTT
ACAAGGCTGTCCCTACAATGATTCTCAGCATCTTCTTCAAGTCTAGCAACAAAATCATACCGATAATCATCATGAGCAGAATGTTCAAGAGATCCGTCAA
ATTTTTGCCTTACAACTTCTAAGGCAAAGCGCCGGATCAATCTGTTCAGGTAGGATACGTTGGAGTCATAATACTTATCCCTCAGGTTCCGAGTCATCAA
GCCAGCTTCAATTGTAATGCCCAGCAGGGCAGCTTTTTTAACCAGAAGAGCAGCATCAGAACAAGCCTGAGAACCTTTCATGCAACTTAAGGCAAACATC
CGTATCTGTGTGCTCTCGTGGGGTGATTCTTCAGGGTCCAGAAGACTGGGATGACAGCTCAGCCTCTCAACGATCAACTCGCTCTCCTTCGCAACACATG
TGGCAGCGATCATGGAAATAGGAGAATCTCCTTCACCGCTGTTGGAACGGATAAGTTCATAAGCGCAGTTTTGGATATTGTCACTCAGACTGATCTCATC
ATGGGGGACATGGGTGTGCTTGTACAGCCACTCANACTTCAATCTAATTTCCTGAT
page-top