Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EM_all.Contig2
Contig Information
Length 643 bp
Tissue Dormant seed with water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhem4m20   
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 375
Evalue 2.08175e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EM_all.Contig2
ATGGTGGACGGAAAGAGTAACCATCTAGGTACAAGCAGGGGCACCCCGGCGCTGGGAGCATACACCCTCCAACACAAGGGCACCCCGCCGGCAGCGGCGC
CAACAGGGAGCGCTATCCGTTATAGCAGGACAATGACAAGAAAAAAGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCTAGTGGAGATG
GATAGGCTCCTTATGACACCACCGCACACAGCTCAGGTCGCTTCTCGCACAGCAGCTCCCGCATTGTCCGCTTCACTCGTCATCGTCCTCGTCCTCGTCG
CTACCCTCATCGTCATAGTCATCATTGATCTCCGACTTGGACTTGTCGGATTCCTCCTCATCGTCCTCCTCTACCTCCTTGGCCGCCGCCTTCTTTGGGG
CAGCAGCAGCAGCACTCTCGCCCTTGTTGTAGGCGGCAATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACGTAGGGGGCCTTCTCCGA
TTCGCTCAAGCTCTTCCACCTCTCACCGGCCGCTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCC
ATGAAGACGAANAAGGCGGANGGCGCCCTCTTGGGCTTGTTGG
page-top