Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2489
Contig Information
Length 1942 bp
Tissue Seed DPA20
Clones 60 Clones [Download: CSV  ,  FASTA ]
whdp10a24    whdp10b14    whdp10k03    whdp1k22    whdp2b16    whdp2c08    whdp4b05    whdp4c24    whdp5b05    whdp5d13    whdp5k06    whdp5o07    whdp7e07    whdp7f06    whdp7h14    whdp9p06    whdp12c17    whdp12k12    whdp15d23    whdp17b06    whdp17l17    whdp18a22    whdp18f08    whdp18i02    whdp19g19    whdp19j04    whdp20j19    whdp20j24    whdp20m15    rwhdp10a24    rwhdp10k03    rwhdp1k22    rwhdp2b16    rwhdp2c08    rwhdp4b05    rwhdp4c24    rwhdp5a03    rwhdp5b05    rwhdp5d13    rwhdp5k06    rwhdp5o07    rwhdp7e07    rwhdp7f06    rwhdp7h14    rwhdp9p06    rwhdp12c17    rwhdp12k12    rwhdp15d23    rwhdp17b06    rwhdp17e02    rwhdp18a22    rwhdp18c01    rwhdp18i02    rwhdp19g19    rwhdp19j04    rwhdp19m16    rwhdp20j19    rwhdp20j23    rwhdp20j24    rwhdp20m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase; AltName: Full=Beta-Amy1; Flags: Precursor
Score 2431
Evalue 0
Total Hit Count 315
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2489
TTTTTTTTTTGAGCACAAAATAGTTTGTTCATTCACTCATATGCACATAATGGAGGTATGTAAGGTCTGATGTACTACAGCTCATTGGAAAAGCATCCTC
TTGATGACTAATCCAATATTGATGAGTAATCCTCATGATGTACTGTAGCACCACATCTTATTTATCCTCATCGGCTTATTTCTAGGGCACGGTTAATTCT
CACAAAGAGAAGATTAACCCTTCCAGCACTGAGATTTTTCTTCCAGAACACGCACAAGTGATGTGCTTTATTTATTGCTATTAATAAGGCAGAGAAAGGT
TTCTCTGTCACACACAACATAAAAGGTACTGTAGATCATAAAGGTTTCATTACACGGTGGCAGGGAGCTCCCCACCCATGCTACCAGTGGGGTCTTGAAC
CTCCCCACCCATGCCACCAGTGGGGCCTTCAACATCCCCACCGATGCCACCGAGGCCTTGAACTCGCAGGTCGGTGTGCTCTTCAAAGGGGAATGGATCC
AGTTTTGGCTGCGCTGCTTGTAGGATCATTTCAATCGTCAGTTCTGGCCCTGATCTTTGCAAAGGCGCCACTGGATCAACACATGGGTCATGAGGCAGGT
TGGCATGCATTCTGTCAACAAAGGTCTTGAAATTGACATAGTTTTGTCCCTCCACCAACTGATTCGACAGCCGGAGGTAGGTGAATCCAAACAGCTTGTG
CTCAGGAGGGCCGCTCTTGTTGATGCCATGAGGCCTTGCATTCCTGAGTATGGTGTTGTAAGCAGTTGGATCATATCGAGGAAGTGCATTTTCGCATGCC
ATATTTAGGCCCTCTCTCCATCCAGCACTCAACACCTGTTGGACTAGTTCTTCCGGTGCGCTCATGGCCTGTGAGCTTTGCTCCGAGTCCCTCATCTCGG
CGCAAGTGAAGTTAAGACTAGCACGGTGCCTTTTGAGCATGCGTGCTATGGGTCTGTAGCCATCTCTATCATGTAAGTTGTAGTACCCAGCTGTGATCTC
GGCTGCATGGCTTGGAACCTTGTACCACCAGTGAATGCCAGAGATTTTGATTGCCAGTTGCACTCTGTGTCCCAAGAAGACCTTGTTTGCTTCGTCCAAG
ATCTTGTCACCGTGCTTGATCAGGTTATTGGAGTACCATGCAAGGAAAAACCTCCCCTGCTCAGTGAGATATGTTCCGTTGTCCACGAAGAATCGAGTTC
TCTGGGGAGTGTCATTGTACTGTCCGGCATCGCGAGGAAATTCCCACTCAGGATGGCCAACCATCGCTGCTGCTGCTTTGAAGTCTGCTTGCAGGTACTT
ATCATAGCAGATGAATTCTCCGATGCCTGGGAATGACCATCCATGGCTCTGAGGATAGGATGGGTACCTCAACTCTCCAGCCGGGCCAAGTCCGACTTCA
ATGTCTACAATAACACCGGCATCCAAGAACTCTTTCATGTTGTCCCTGAAGCTTGCCATGTAATCAGTATACATCTGGACGGCAGATCTTCCATGGAAGA
GAGGCTGGTCATCAACTCCAAGGGTGAGGTACTCAATGTTCCTAGTCCCGTGCTGGTCGGTGTAGAAAATGTCCGGATCACTCGCACCGACATTCCGCAC
CCACTGCGGGATCGGGATGTTGACGACATCACCGACGTTGCCACCACACTGGTGGAATGACATGATGGCCTTTAGCTTCAGTCCAGCCTCATGCACCAGC
TGGAACAACTGCTTGTAGGCGGACCAGTCGTACGCCCTGGGGCCCTTGGCCTCCACCAAGCCCCACCAGACGTCTACCATGACACCATCCACACCGGCCT
CTACCAGCCTCTTCAGTTGCTCCCTGAGCTCGTCACCCTTCTCGAACCTGTTGTTCACGCTCACGGCGTCCAGAGGGAGCATGACGTAGACTTGGACATA
GTTGCCTTGTTGCACGCTCGCTTCCATTGTGGCTGCTGGCTG
page-top