Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2479
Contig Information
Length 1157 bp
Tissue Seed DPA20
Clones 38 Clones [Download: CSV  ,  FASTA ]
whdp10c06    whdp10h18    whdp2e05    whdp3b15    whdp4e17    whdp4h03    whdp6l11    whdp6n03    whdp7e06    whdp8b06    whdp8n16    whdp11l08    whdp13c23    whdp13f23    whdp13f24    whdp14n07    whdp14p14    whdp15p24    whdp17f19    whdp19c09    rwhdp10c06    rwhdp10h18    rwhdp2e05    rwhdp3b15    rwhdp4e17    rwhdp6l11    rwhdp6n03    rwhdp7e06    rwhdp8b06    rwhdp8n16    rwhdp11l08    rwhdp13c23    rwhdp13f23    rwhdp14n07    rwhdp14p14    rwhdp15p24    rwhdp17f19    rwhdp19c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-gliadin [Triticum aestivum]
Score 405
Evalue 1.96541e-37
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2479
TTTTTTTTTTAAAATAAAAAGTGAATGTAACAGTGACAAGCAATGCTAGCAAACAAGAACTTTGTTTGTCTTTTATTCCCAAGCTTGAACTAGCACTGGT
CGGGGTCACACATGATGGCGTACGCCACTTTATTTGTCATCGCTACAACGATTGGTGCATCAGCTAAGCAACGATGATCCATCTACCTATTAGCATAACT
CTTGCATTTTTCATTGGCCACCAATGCCGACGACTATGCTGGCAAATGGTGCGTTGATGGTGGAGCAGTCAGGTGAGACATACACGTTGCACATGGTTGG
AAGAGTTCTCAATACCAATGACCTGATCACCTCCAATTGAGCTGGTTGTTGAGGTTGGATGATGCCCTGACCCTGAACGAGCTGAAACAGTGGCCGCCGG
ATCTGCACGCCTTGTCGTTGTTCTTGCTGCATGATGATGGAATGCACGACACTATGGATGGCTGCACACTGGAGCTGCTGAGGAATCTGTGCCAGTTGTT
GGCAACATTGTTGCTGCATCACCTGGCAATCACTTCGTGGCAAGATCATTGATATGAGGGATGACACCAATGACACAGGGTTGCATTGCTGCAAGAGAAA
ATTCTTGCAGGGGTTCATCTGTTGTTGTAGAGATAGCTGAATCAACGGTTGTTGTTGCTGGGGGAATGATTGTTGCGGTTGTTGGGGCTGCAGGAATTGT
TGTTGGGGCTGGGGAAAAGGTTGTTGTGGTTGCTGTGACTGGGGAAATTGTTGTTGGGGTTGTTGAGGCTGGGGGAATGGTTGTTGGGGTTGTTGGGGAA
ATGGTAGTTGGGGTTGTTGGGGGAATGTTTGTTGGGGCTGGGGAAATGGTTGTTGTGGTTGCTGGGTCTGGGGAAATTGTTGTTGTGGTTGATGGGGGTA
TGTTTGTTGGGGTTGGGGAAATGTTTGTTGTGGTTGATGGTGGAACGTTTGATGGGGTTGGGGAATAGTTTGTTGTGGTTGCTGGCAGAATGGTTGTTGG
GGCTGGGGGAATGGTTGTTGTTGTGGCCAATGTACTTGGTAGCCGGGGTCGACTTGCATATTGGCGGTGGCGATGGTTGTTGCCATCGCAAGGATTGTTA
CCGATGAGTAAGGTCTTCATGGTGGATTTGCGTTAGGTACTACTTACTTGGATTTGA
page-top