Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2478
Contig Information
Length 1158 bp
Tissue Seed DPA20
Clones 35 Clones [Download: CSV  ,  FASTA ]
whdp10e03    whdp10e04    whdp4c08    whdp5h13    whdp7i01    whdp8k19    whdp8n12    whdp9d06    whdp9p18    whdp11c09    whdp13d02    whdp15p17    whdp17n15    whdp17o05    whdp19f19    rwhdp10e03    rwhdp2d10    rwhdp4b11    rwhdp4c08    rwhdp5c08    rwhdp5h13    rwhdp7f02    rwhdp7i01    rwhdp8k19    rwhdp8n12    rwhdp9c07    rwhdp9d06    rwhdp9p18    rwhdp11c09    rwhdp13d02    rwhdp15p17    rwhdp17n15    rwhdp17o05    rwhdp19f19    rwhdp20b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dimeric alpha-amylase inhibitor [Triticum aestivum]
Score 692
Evalue 1.03253e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2478
TGCATTGCATGCACGTTACATTATTTATTTAACGCTTGACGCTTCCAAGTGGCTACAGCGCCAAAAGCCCCTACCGAACACACAACCGAACTACTACCAG
CTGACACTCGAGACTCGACACGCCGCACTTGCTCGTACATACCACACACCACACCACGGACACACTTCACTCTTGTTCTTCGCGATCTTCTCTATCCCTG
ATCTAGCTATTGACGATGGTGCCACCGTTGGGGTGGAGGATCTGGCCGGAGATGTAGGAGGAGTCCTGCTCGCTGGCCAGGAAGACGAAGCTGGGCGCGA
CCTCGCTGGGCTGCCCGGCGCGCTTCATGGGCACCTCGGACCCGAACTGCTTCACCTTCTCCTCCGGGAAGGAGGCCGGGATGAGCGGCGTCCAGATGGG
CCCCGGCGCGACGCCGTTGACACGGATCCCCTTCTCCGCCAGCTGCATAGACAGCGCGCGGGTGAAGGCCACGATGGCGCCCTTGGTGGCCGTGTAGTCC
AGCAGCGTCGCGTTGCCCTTGTACGCGTTCACGGAGGTGGTGTTGATGATGCTGGACCCGGGCCGCACTCGGTGCTCCTACTATGTATGCTCGTGGCGAC
ACCCATAGCAGCCGAGTACGACGCATGGAGCGGTAACAGTGGTCCTTGGATGTGCTATCCGGGGCAGGCCTTCCAGGTGCCCGCGCTCCCCGCCTGTCGT
CCATTGCTGAGGCTCCAGTGCAATGGCAGCCAGGTGCCCGAGGCTGTCCTAAGGGACTGCTGCCAGCAGCTCGCCCACATCAGCGAGTGGTGCAGGTGCG
GGGCCCTCTACAGCATGTTGGACAGCATGTATAAGGAGCATGGCGCGCAGGAGGGACAGGCAGGGACAGGAGCGTTCCCACGCTGCCGGAGGGAGGTGGT
GAAGCTGACGGCGGCGAGCATCACAGCGGTCTGCAGGCTACCCATCGTCGTTGATGCGTCCGGAGATGGAGCGTATGTCTGCAAGGATGTGGCCGCATAC
CCAGACGCCTAGTCAAGCAAATGAGTAGCTACTATGTTGTGTCATGCACCTGCCTCTTAATTTGTGGGAGTGCGCACAAACTAAATAAAATGGTGTATGT
GCCTATGCGAAATGCATTGGTAATGAATAAAAGTGAAGTTCCCTGTTTAAAAAAAAAA
page-top