Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2471
Contig Information
Length 1080 bp
Tissue Seed DPA20
Clones 32 Clones [Download: CSV  ,  FASTA ]
whdp10b24    whdp2o06    whdp3c11    whdp3g24    whdp4g24    whdp4j21    whdp5m07    whdp5p07    whdp6i24    whdp6k18    whdp6l20    whdp6o11    whdp7f15    whdp11g02    whdp13a18    whdp13j13    whdp18h16    whdp19l15    rwhdp1l22    rwhdp3c11    rwhdp3g24    rwhdp4g24    rwhdp4j21    rwhdp5m07    rwhdp5p07    rwhdp6i24    rwhdp6o11    rwhdp7f15    rwhdp11g02    rwhdp12l19    rwhdp13j13    rwhdp19l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha gliadin [Thinopyrum ponticum x Triticum aestivum]
Score 415
Evalue 1.22979e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2471
GTAGAGCGCATCATTTAAGCCAAGCAAGCAGTGCTCAATACAAATCCACCATGAAGACCTTTCTCATCCTTGCACTCCTTGCTATTGTAGCAACCACCGC
CACAATTGCAGTTAGAGTTCCAGTGCCACAATTGCAGCCACAAAATCCATCTCAGCAACAACCACAAGAGCAAGTTCCATTGGTACAACAACAACAATTT
CCAGGGCAGCAACAACCATTTCCACCACAACAGCCATATCCGCAGCCGCAACCATTTCCATCACAACAACCATATCTGCAGCTGCAGCCATTTCCGCAGC
CGCAACTACCATATCCGCAGCCGCATCTACCATATCCGCAGCCGCAACCATTTCGACCACAACAACCATATCCACAACCGCAACCACAGTATTCGCAACC
ACAACAACCAATTTCGCAGCAGCAGCAACAACAACAACAACAACAACAACAACAGATCCTTCAACAAATTTTGCAACAACAACTGATTCCATGCAGGGAT
GTTGTATTGCAACAACACAGCATAGCGCATGGAAGCTCACAAGTTTTGCAACAAAGTACTTACCAGCTGGTGCAACAATTGTGTTGTCAGCAGCTGTGGC
AGATCCCCGAGCAGTCGCGGTGCCAAGCCATCCACAATGTTGTTCATGCTATTATTCTGCATCAACAACAACAACAACAACAACAACAACAACAACAACA
ACCGTTGAGCCAGGTCTCCTTCCAACAGCCTCAACAACAATATCCATCAGGCCAGGGCTCCTTCCAGCCATCTCAGCAAAACCCACAGGCCCAGGGCTCT
GTCCAGCCTCAACAACTGCCCCAGTTTGAGGAAATAAGGAACCTAGCGCTAGAGACGCTACCTGCAATGTGCAATGTCTATATCCCTCCATATTGCACCA
TTGCTCCAGTTGGCTTCTTCGGTACTAACTGAGAAGAGAAGAACTCTAGTAGTAGACATATGATACACCGTTTTCTTAGTCCATGGTTTGGTCGTTGTAG
CGGTGAAAAAATAAAGTGACATGCAGTATCATGTAAGAACCCGAACTATACTAGTTCAAACCATGGGAATAAAAGACAAA
page-top