Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2470
Contig Information
Length 1099 bp
Tissue Seed DPA20
Clones 32 Clones [Download: CSV  ,  FASTA ]
whdp10c21    whdp10n04    whdp3g16    whdp4h20    whdp9d08    whdp9g15    whdp9g16    whdp11n08    whdp12n19    whdp13j12    whdp13n15    whdp16g05    whdp16j16    whdp17g11    whdp17n02    whdp18n13    whdp20b03    rwhdp10c21    rwhdp10n04    rwhdp3g16    rwhdp4b06    rwhdp4h20    rwhdp4n08    rwhdp6o21    rwhdp7g19    rwhdp9d08    rwhdp9g15    rwhdp12n19    rwhdp13j12    rwhdp16g05    rwhdp17g11    rwhdp18n13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha gliadin [Thinopyrum ponticum x Triticum aestivum]
Score 479
Evalue 4.78781e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2470
GTAGAGCGCATCATTTAAGCCAAGCAAGCAGTGCTCAATACAAATCCACCATGAAGACCTTTCTCATCCTTGCCCTCCTTGCTATTGTGGCGACCACCGC
CACAACTGCAGTTAGAGTTCCAGTGCCACAATTGCAGCTACAAAATCCATCTCAGCAACAGCCACAAGAGCAAGTTCCATTGGTACAAGAACAACAATTT
CCAGGGCAGCAACAACCATTTCCACCACAACAGCCATATCCGCAGCCGCAACCATTTCCATCACAACAACCATATCTGCAGCTGCAACCATTTCCACAGC
CGCAACTACCATATCCGCAGCCGCAACCATTTCGACCACAACAACCATATCCACAGCCGCAACCACAGTATTCGCAACCACAACAACCAATTTCGCAGCA
GCAGCAGCAGCAGCAGCAACAACAACAACAACAACAACAAATCCTACAACAAATTTTGCAACAACAACTGATTCCATGCAGGGATGTTGTATTGCAACAA
CACAACATAGCGCATGGAAGCTCACAAGTTTTGCAAGAAAGTACTTACCAGCTGGTGCAACAATTGTGTTGTCAGCAGCTGTGGCAGATCCCCGAGCAGT
CGCGGTGCCAAGCCATCCACAATGTTGTTCATGCTATTATTCTGCATCAACAACACCACCACCACCAACAACAACAACAACAACAACAACAACAACCGTT
GAGCCAAGTCTCCTTCCAACAGCCTCAGCAACAATATCCATCAGGCCAGGGCTTCTTCCAACCATCTCAGCAAAACCCACAGGCCCAGGGCTCTTTCCAG
CCTCAACAACTGCCCCAGTTTGAGGCAATAAGGAACCTAGCGCTACAGACGCTACCTGCAATGTGCAATGTGTATATCCCTCCATATTGCACCATTGCTC
CATTTGGCATCTTCGGTACTAACTGAGAAGAGAAGAACTCTAGTAGTAGATATATGATACACCGTTTTCTTAGTCCATGGTTTGGTCGTTGTAGCGGTGA
AAAAATAAAGTGACATGCACTATCATGTAAGAACCTGAACTATACTAGTTCAAACTTGGGAATAAAAGACAAACACAGGTCTTGTCTACAAAAAAAAAA
page-top