Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2468
Contig Information
Length 795 bp
Tissue Seed DPA20
Clones 28 Clones [Download: CSV  ,  FASTA ]
whdp3n02    whdp4a14    whdp4a15    whdp5c06    whdp6a20    whdp6h02    whdp8i02    whdp8l19    whdp9n20    whdp15p02    whdp19o05    rwhdp10f21    rwhdp3n02    rwhdp4a14    rwhdp4a15    rwhdp4b15    rwhdp5c05    rwhdp5c06    rwhdp6a20    rwhdp6h02    rwhdp8i02    rwhdp8l19    rwhdp9n20    rwhdp15p02    rwhdp18m16    rwhdp19a10    rwhdp19o05    rwhdp19o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Translationally-controlled tumor protein homolog; Short=TCTP >gi|21070379|gb|AAM34280.1|AF508970_1 translationally controlled tumor protein [Triticum aestivum]
Score 808
Evalue 2.00764e-84
Total Hit Count 334
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2468
TTTTTTTTTTAGCGAGTAAAAGCCGAGGCATTGACCAAAACATAACCACACCAATTTCACGATTACCATTACAAAGCAAATCCCACAATTATCAGAAAGT
TTTCAAGACACTCAACATCTGATAGTTACCGACACAACATTGGAGAGTCGACTGACAACCATAGAGCAGAGCAAAAATACTGACGACCGCATAGATTTTA
GCATACAGTGCGATTAGCACTTGACCTCTTTCAGCCCATGTGCAAAGTACAGGAAAGTTGGATCAGCAGCTCCCTCCTTGTAGTAGGCGAACACCACGCC
GCCATCATCATGCATGCTCTCGCCAACAAAGAACTGAAGGTCCTTGAGCTTGCTAAGAAGATACTTTGTGGCAGACTCAACATTCTTCTTGAAAACATCT
AGGTCATCCCCTTCAAGCTTGGCAGAGAGGTTCTTGATGTAGCGCTTCATGTGAGAGATAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGA
AGGTGTCAACAATGTCAACCACCTTCACGGCCTGGTCATCGACACCCTCATCATCACCACCACCCTCAGCAGAGGGATTGGCTCCAATGTCCACATCAAC
TGCTCCTTGAACGACCCAATGGCCGTCGACTTCCCAGAGCACGCCGTTCTCCAGCTCCCTGTACGGGAACGAATCCGACAGAAGCTCGTCGCCGGAAAGC
TTGTCCTGGTACACGAGCATGGTGCCGCCTCTTGAGATTTCTCCCCCGAAAAAGGAGAAAACCCTAACGAGCTCTGGGGGAGGCAGGGGAGTAGC
page-top