Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2448
Contig Information
Length 699 bp
Tissue Seed DPA20
Clones 18 Clones [Download: CSV  ,  FASTA ]
whdp10b16    whdp1i14    whdp1i24    whdp1m20    whdp2o15    whdp7m23    whdp11o10    whdp16a20    whdp16c21    rwhdp10b16    rwhdp1i14    rwhdp2o15    rwhdp3a08    rwhdp7m23    rwhdp11k12    rwhdp11o10    rwhdp16a20    rwhdp16c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Alpha-amylase/trypsin inhibitor CM3; AltName: Full=Chloroform/methanol-soluble protein CM3; Flags: Precursor >gi|100834|pir||S16031 alpha-amylase inhibitor, tetrameric, chain CM3 precursor - durum wheat >gi|21713|emb|CAA35597.1| unnamed protein product [Triticum aestivum] >gi|21922|emb|CAA43367.1| CM3 protein [Triticum turgidum subsp. durum] >gi|38098487|gb|AAR10959.1| alpha amylase inhibitor protein [Triticum aestivum] >gi|39578552|gb|AAR28678.1| alpha amylase inhibitor CM3 [Triticum turgidum subsp. durum]
Score 766
Evalue 1.13599e-79
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2448
GCGAACCAGACTTGGNTAGAATACCATGGCGTGCAAGTCCAGCTGCAGCCTCCTCCTCTTGGCCGCCGTCCTGCTCTCCGTCTTGGCCGCTGCTTCCGCC
TCCGGCAGCTGCGTCCCAGGGGTGGCTTTTCGGACCAATCTTCTGCCACACTGCCGCGACTATGTGTTACAACAAACTTGTGGCACCTTCACCCCTGGGT
CAAAGTTACCCGAATGGATGACATCTGCGTCGATATACTCCCCTGGGAAACCGTACCTCGCCAAGTTGTATTGCTGCCAGGAGCTCGCAGAAATTTCTCA
GCAGTGCCGGTGCGAGGCGCTGCGCTACTTCATAGCGTTGCCGGTACCGTCTCAGCCTGTGGACCCGAGGTCCGGCAATGTTGGTGAGAGCGGCCTCATC
GATCTGCCCGGATGCCCCAGGGAGATGCAATGGGACTTCGTCAGATTACTCGTCGCCCCGGGGCAGTGCAACTTGGCGACCATTCACAATGTTCGATACT
GCCCCGCCGTGGAACAGCCTCTGTGGATCTAGAGATAAAATCAGTCGCTCGTGAATAAGCATGCATGTTGCATCCATAGGCGTGTGGTGTGCATGTATAC
ATATGTGAGCTCCGCGCGCTCAACATGTGTGGGCTATCTGCTATGAATGAGAATAAAGAGAATCATTCTGTGGTTCTTTAATTTCAACTAAAAAAAAAA
page-top