Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2444
Contig Information
Length 1155 bp
Tissue Seed DPA20
Clones 17 Clones [Download: CSV  ,  FASTA ]
whdp10e02    whdp2c16    whdp4c06    whdp4h19    whdp6p20    whdp9i02    whdp14g14    whdp16m21    whdp20j05    rwhdp10e02    rwhdp2c16    rwhdp4c06    rwhdp4h19    rwhdp6p20    rwhdp9i02    rwhdp14g14    rwhdp16m21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aspartic proteinase oryzasin-1 precursor [Zea mays]
Score 1203
Evalue 5.75526e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2444
ATTACTTTCATGTTTAGGAAGTTCGATGGCATTCTCGGTCTTGGATTTAAAGAAATCGCTAGGGGCGGTGTTGAACCTGTCTGGTACAACATGGTTAACC
AACATCTGGTTGGTAGCCCTGTTTTCTCGTTCTGGTTCAACCGGCATGCTGGCGAAGGGCATGGGGGAGAAATTGTGTTTGGAGGAATTGATCCTAAGCA
TCACAAGGAAGAACATAAATACGTTCCTGTTACTAAGAAGGGATATTGGCAGTTTGATATGGGTGATGTCTTGATTGGAGGAAAGTCCACAGGATTATGT
ACATCTCGCTGTGCAGCTATAGCAGATTCGGGAACTTCGTTGCTTGTTGGTCCCACTGCAATAATTACTCAGATAAATGAAAAGATTGGTGCACCTGGGA
TTTTCAGCCAAGAGTGCAAGGAAGTTGCTTCTCAGTACAGGCAACGGATCCTAGATCTATTGCTAAATGAGATCGACCCAACAAAAATATGTCCTTCTGT
TGGTCTATGCACTCACAGTGGAACTCAAGGTGTAAGTAATGGCAGCTTTGGTATTCGGACTGTGGTAGATGATGAAACCGGGAGATCAAATGATGCCGTG
TGCCATGTTTGTGAGATGGCTGTTATGTGGGCAAAGAACCAACTTGCACAGGATCAAACACGGGATCTTATATTGAAGTACATTAATACGCTATGTGGCT
ATATCCCTAGCCCTATGGGAGAATCATCAGTGGACTGCAAAAGACTTGCATCCATGCCTGACGTCGCCTTCTCCATCGGCGGCAAAAAGTTTGCACTCAC
ACCAGAGCAATACATCCTGAAGATTGGCGAGGGAGATGCTACTAAGTGCATCAGTGGATTCGTAGCTATGGACATTCCTCCTCCCCGTGGTCCTATCTGG
ATCTTGGGTGATATATTCATGGGAGCCTATCACACTGTCTTTGACTATGGTAAAATGAAGGTTGGCTTCGCGAAGGCGGCATAGATGACCGGATGAGCTG
CAGAGGATCCGGCTTTTCAGGCCAATTTCATGCTCATAGATGCTTCATAATGCATGTGTGGTCTGAGATTAATAAGTATGTATATTTTGATTTGGCCAAG
ATATAGTAATGATTCCATATAGACATGGTTACTATTAATTGTCCCAAAAAAAAAA
page-top