Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2437
Contig Information
Length 1625 bp
Tissue Seed DPA20
Clones 15 Clones [Download: CSV  ,  FASTA ]
whdp10d06    whdp9d20    whdp9d22    whdp9n15    whdp16j07    whdp17e15    whdp19g11    rwhdp10d06    rwhdp9d20    rwhdp9d22    rwhdp9n15    rwhdp16d12    rwhdp16j07    rwhdp17e15    rwhdp19g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0484600 [Oryza sativa (japonica cultivar-group)] >gi|4107001|dbj|BAA36299.1| OSK4 [Oryza sativa] >gi|28201242|dbj|BAC56589.1| SnRK1b protein kinase [Oryza sativa Japonica Group] >gi|42409397|dbj|BAD10710.1| serine/threonine protein kinase(OSK4) [Oryza sativa Japonica Group] >gi|113624052|dbj|BAF23997.1| Os08g0484600 [Oryza sativa (japonica cultivar-group)] >gi|215704275|dbj|BAG93115.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215713532|dbj|BAG94669.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201334|gb|EEC83761.1| hypothetical protein OsI_29652 [Oryza sativa Indica Group]
Score 1191
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2437
TTTTTTTTTTAGTCACCCAAACAACACTTTTGGTGCTTCCACAGGAACTAGTCACCCAAACAACACGGTTCGCTGTCAGGGACTGGGTAAAACGAAGATG
AAACACACCACCTATTTACACACCATCACTTATTCATCTCTGACAGTCACATGTCTCACTATTCATCACTCAACCAGAACAGGCACCAACTTATTCATCG
CTGACGGTCATATGTCTCACTATTCATCACTCAACCAGAACAGGCACCATACTATAGAACCCTAAGGTTGGTAAGGAAGGCCGCGCAAAAATCCAGAAAG
AGGAGCTGAGGTCCAGTAACTCTCTGCATATCTAGCAGGTACTTGTCATCCTTGGTCTTGTAAAGCTGGATTTCAAACTTGATCACGGCAGGTAGCCTCC
CATTAGCATCGCCGTTATCCATGATGGTAGAGTCATCAACAAAGCTGTGGTTGGCATCTAACATATCACTGACCTGAGGAAACCCAGGGCACCACCTGCA
TTTCATGTTGTAGTGTCCATTCTTCTTCCAGCAGACATTTAATTCTTGAAGTGCCTTTAGAACCTCGATCATTATCTCACGAGGTTGAGCTCGAGACTGG
AGCCCAAGAGCCCATTTTCTTTCAACGGGGTAATATGGCCGCAAGCCACTGCCTTGAGAATCATTGCTTGCTGGAAGATACTGCCTGGTACTTGGGCTTG
CTGATTCCAATGAAGTAAACTGATTAAAACTCCTACCCATTGATTGTAGATAGTCAGCCCCCAAATAGCCACTAGTGGCCCGGAACCGATTGTCCAAGAG
TAAGTAATATGCAACAGTTGCCTCATTTTGCAGCCTATTGCACAATGATTCACACACATGGTCTTTATCATATCCCAGGTTGACAATCTCTTTAAGTGTA
TCTTCATCAATCATTTTGGGCTTGCTGCGCCGTGTCTGGTGGAGGCACTGCCAGGTAGCGAGGAAGGCGATTCTGAAACCATGGGTGTTCTCGAATTTCA
CGAATTGTGATTCTCTTCATAGGATCAACAACAAGCATTCTTGGGATCAAATCCCTTGCAAGAGCAGATAAATGACTTGGAAGGATATAGATGCCTCCCT
TTATCTTTTTGAACAGTTTGGGAATATTGTCATCATCAAATGGAAGAGTGCCACAAAGAAGAGCATAAAGTATCACCCCGCAGCTCCAAACATCAACCTC
AGGTCCAGCGTATAATTTACCTGAGATAACCTCTGGTGCAGCATAGTTTGGACTCCCGCAGCTAGTCTTCAGAAAATGGCCATCATGCATGACATTACTT
AACCCAAAGTCGGCAAGTTTCACATTGTATTTGGAATCAAGTAACAGGTTCTCTGGCTTTAGATCACGATGAGCAACCATGTTTCTGTGGCAGTATTCAA
CACCAGATATAATCTGCTGGAAGATTCGACGAGCCTCATCTTCCTGTAACCGCCCTTTCTCAACAATGCAGTCGAATAGCTCACCATACTTGCAATATTC
CATCACAACAAATATATCTGTAGGTGTGTAAATGACCTCATAAAGCCGGATGATATGAGGGTGGATGAACAACCTCAATATCTTGATCTCTCTCTTTGCT
TTCTCCTCCATTTCCATAGTTCTCA
page-top