Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2431
Contig Information
Length 503 bp
Tissue Seed DPA20
Clones 15 Clones [Download: CSV  ,  FASTA ]
whdp10b04    whdp4g20    whdp6d18    whdp13k07    whdp14i24    whdp17n05    whdp19k15    rwhdp10b04    rwhdp4g20    rwhdp6d18    rwhdp6l16    rwhdp13k07    rwhdp14i24    rwhdp17n05    rwhdp19k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_04085 [Oryza sativa Indica Group]
Score 95
Evalue 0.0311352
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2431
TTTTTTTTTTAAGTCATAACTGACAGCAATCTCCTCCTCATACTTTATTAAACAAGGTTTCACATCACAACAACATGCTTGGAATGAAAAGTTCTGAAAC
ATATATATAGAGACACGAAAAGCAGCGGAATTATAGATGTATGCAGATTGCAGATCCAGTAGAATGTATCATGTATGCTCACGTCACGGACACATTTCTA
GGGAGGAGAGCGACCCCCACAGGCCGCCGCAGGCGAGTCCGTCAGGGATTAACGGCGGCGGCGAGCGGGGCTTCCGCCGTCAGGCGCTCGCAGCACTCGG
GGCGGTAGGAGCAGCACGCGGGAACTCCGGGCACAGCCCTGCCCTGCACCTTCGCCGACGCGGCCATCATCAAGAATAGGCAGACCTGCACGAGGAGGAA
AACCAGCAAGGCACGGAGGTGACCCATCGCCATGGTCTCTCGCGGTTGTTGTTTTGCTAGCACAAACAGTAACACGAGAAGGAGAGGGAGCACTAGTATT
TCC
page-top