Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2425
Contig Information
Length 1348 bp
Tissue Seed DPA20
Clones 14 Clones [Download: CSV  ,  FASTA ]
whdp10c09    whdp10n11    whdp1p23    whdp9c01    whdp11n02    whdp13k08    rwhdp10c09    rwhdp10n11    rwhdp1p23    rwhdp5c21    rwhdp9c01    rwhdp9c12    rwhdp11n02    rwhdp13k08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serpin-Z7; AltName: Full=HorvuZ7; AltName: Full=BSZ7 >gi|1197577|emb|CAA64599.1| serpin [Hordeum vulgare subsp. vulgare]
Score 1563
Evalue 1.29386e-171
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2425
TTTTTTTTTTCTGAAAATCAGAACCATTTATTGGATTGATTGCACAAGCAACCTTATTGGATGTTGAAACCCTTCCCTTACATGTAATAGTTGAGGCAAC
TGCCAACACACATATTTAGGGCAAACATATTATGAAGACACGAGGGGATTGGCCACATGACCGATGAAGAGAACCACACCAGTGACGTCTTCTCGGATAA
GGAAGAGGAAAGGGTGATCTGCAACGAAGTCCATCACAATGGGCATCTGTTGTTGTTCGATCGCTACACTAGTTGCTGCTGCAGCCTCAGTTCCTTGTTC
ATTCACTTCGACAAATGACTTGTGGAAAACAGATGAGAGGAATAGGTCCACCTGAGAATTCACCATCTCTGACAGGTTTGCCTCCCTGCTAAATGGCAAC
TGAAGACCCAAACTCTTGAGCAAATTGGTTGCTTCAAATCCAAATGATATCTTGAACTTTGGAAGCATGAACTGATCAACTACAACTTTCTCCGTTGGTA
TATGCTTCTCGATGAACTCTGATTCAGTGCTCAACCTTTTGGCCAAGGTCCAGAGATCATCACGTCTTTCAGGAAGAAGAATGTACATGGAGAATTGCCT
ATTGTCTCCACCTTTCTGATATGGAAGCTTAAGTACCTTCAAGCCGTCGGAAGATGAAATGTATTGCTTATTTGTACTGGACATGAATGGTGTTTGAACA
GTGTTCCCATTTAAAAGGTGGAACTTGTCGTATTTTGTCTTAGATTCGTCAAATTTCTCAGTCCAAAGTCCCTTGAAATAAAGGGCATTACCAAGAACCA
GTCTAGTGGTGTAGTCAATAGACCCTTCAGGGAGGATCTCTCTGATGAGACCTGTTGTCACATTCTCTACCCATGAGTTCACTTGACTAGCAATTTCAGG
AGCCTTATTCTGGAAGTCCACGGATTGGACCTCAGACTTATAGTTGCACACGGCGAGCTCCTGGAAGGAAGGCTTGAGCGAGAGCGACGCGTCTACAAAA
ACGCCGTTGGCGAAGGCGACGCGCGGGTCGCCGGTGATGGACGCATCGGCAAGCACTAACTGTACCACCTGCTCGGCGAGCGAGTGGAGTCCCTCGGGCC
CGCCTGCATTCTCGTTCCCAAGTATGGCTACGAGCTGGTCGCGGGTGGTGCCGCCAGCGCCGGCAGTAATGAGGCTGAGCGCGACATGGAGTGAGACCGG
GGAGAAGGCGACGTTGCCGGTAGCAGATTCGGGGTCGGATGAGATGGCGGAGGCGAGGCGGAGGGCGAATCGGGTCTGGTGCGCGACCGAGAGGCAGACA
TCGGTGGCAAGGGTGGTTGCCATGGCCGGGGTGGTGGTTCGTCGGACT
page-top