Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2423
Contig Information
Length 1331 bp
Tissue Seed DPA20
Clones 14 Clones [Download: CSV  ,  FASTA ]
whdp10d20    whdp2c12    whdp6p24    whdp11c15    whdp12o12    whdp14k21    whdp17k06    rwhdp10d20    rwhdp2c12    rwhdp6p24    rwhdp11c15    rwhdp12o12    rwhdp14k21    rwhdp17k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein disulfide isomerase 2 precursor [Triticum aestivum] >gi|67508767|emb|CAI30633.1| protein disulfide isomerase precursor [Triticum aestivum] >gi|67508773|emb|CAI30636.1| protein disulfide isomerase precursor [Triticum aestivum]
Score 1634
Evalue 7.42176e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2423
TTTTTTTTTTGATTCTACCAGGCACAGAAGCACCGTTTATTACCAAAGCTCTCCACAGACCATTTCTAATGTCACTTCTCGATAATTTAACTAGGTACAC
CACGGACGGATTTGTTACAGTATTTCTCGCAACGGGATACAGTATCAGGCAAAACCGGGGACAACACATCCAACAACCAACTCTCGTCTTAACCCCCTCG
CAAAATCTGGCGTTGGAAGCTGCCTTGCCAAAACATATTTCCCCCTCCCCTACCTGTCTGCTGCTAGCAACACTGATGCTCAGAGCTCGTCCTTCAGAGG
CTCCGTGGCAGCCGGTTCCGCCGCCTTCTCGGTCGCCGCCTGCCCGGCAGTCTCCTTGTTCTTCTTGATGTAGTCGACAATCTCATCGGCCGTCCTGCCG
CCCTCGTAGGAGACCTTCTTTCCGCTGGGAGTGACGAAGTAGAGGGTGGGGTAACCCTGGACATCGAACTCACTGGGCACGTCATTCGCGGTCGCGTCCA
TCTTCGCGATCACAACGTCCTCTTCGCTTTGAAGGGTGGCAGCTGCCTCGTCGAGGATGGGTGCTAGCTTCTTGCAGTGTCCGCACCAGGGCGCATAGAA
TTCAATAAGAACATTTTTGCCAGATTTGAAGACCACGTCGTGAACGTTGTCAGCCACAACTACCTTAACAGGCTCATTGTTGGCCTCAGGAATAGGCTCG
GACTTCCTGAATGGTGTCAATTTGCCATCGAAGTAATCCTTCAACCAAGCAACAATTTGGCCAGCCTCAACCTGTTCCTTCAAAAACTTCTTCGAGTCAC
TGTCTTGAATGAGGATAAGTGGTGCCTGATCCTCTTTCAGCCCGAAGTACTGGAAAGCGCCTTGGCTCGCTTCAATGTCACCAATTAGGAACTTGACATC
CTTGCCGCTGAACTCCTCTACAGCACCATAGTAGGCTTTCTTGAAGGACTCAAACGGTCCAGTGGAGAAGTTCAAAAAGAGCATGGCCTTGGGAGCATTG
CTCTGGAAGAATTTCAAGAGGTAAGGATGGTTGTCAGGGTTCTTGTCAAAAGTAACAACTTTCGGGGTGCTGCTAGCCTCAATGAATTTCTCCAAAGCAG
AAACATCAAAATCCTTGCTGTCAACAACGAGCTCATCAAATGGCTTGAATAGCCTAACCAATGGCCTCTCCACTGCGGCATCACCACGTGGGAGATGGTT
GGCATGCACGGTGTGGCCAAAGTCATAATCAGACCTCAGCTTCTCAGCAACCTCAAGGAAGTTTGTAAACTCAGTGCCGCTGAATTCCGTGAAGACACCA
ACAATGTGGATCTTGCCGTCTTCGAGGTAAG
page-top