Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2421
Contig Information
Length 1948 bp
Tissue Seed DPA20
Clones 14 Clones [Download: CSV  ,  FASTA ]
whdp10a14    whdp10f18    whdp8d04    whdp8f12    whdp14k24    whdp16j18    whdp19j09    rwhdp10a14    rwhdp10f18    rwhdp10m05    rwhdp8d04    rwhdp8f12    rwhdp14k24    rwhdp19j09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit myo-inositol-1-phosphate synthase [Avena sativa]
Score 2588
Evalue 0
Total Hit Count 411
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2421
TAGCTTACAAAACACGAACAAGGGGAGTGGACTAACTTAGCTAACACGCACCCTCCTCCCTCCACATCATCCAACACCATGGAGTCCATGAGAATCTACC
AAGTCGCAGAGGCCAGACAGAGAGCCGAAATAGTCTCGCAAGGACACACACACACTCACACCAGGGTAAACTTAACCAGGGAAAGAAAGAATCGCAAAGG
AAACCGAAGACAAGCCGCCAAATAATTCCACAGCCGATCTCGCCTTCTTCTTCCTCCTGCCCTCCCGTCGCCCCTCGCCACTTGCTACGTACGTACGGTC
GCTCTCGTCCCCGCGAGCTTGGGCCCTGCTCCTCACTTGTACTCCAGGATCATGTTGTTCTCGGGCGCCAGGCCGACGCACGCCCTCATGATGTTCTCCA
GCATGGCCCTCTGCTTCGCCAGGGCGTTCACCACCGGCGTGCCAGGAGGAACAAGGGGTGCCTTGGTGAGGTAGCTCAGGATGGTGGCAACCGGATGGAA
GGAGTGGAACTTGTCCTCTCCCTCGGCCTTCAGCTGAATCCTGGTGCTGAGCTCGGCCAGGAGCACCAGATCAAGAATGATCGGTGCGGCGAGGAGCGAA
TCCTCGCAGGTGTTGTGGAGCACGATGGTGCTCTTGCCGCCCATGAAGATCTCCGAGGTGTACTCGTCCATGGCCCTCTTGCTGTCTCCAACGTATGGCA
CATACTTGATCACGACGACGTGGTCAGGATGTTCCCCGGGCTCGTAGAGGATAGCATTGCTCGAGACCATGTCATCCACCACGTTACTCTTGGAGATCTC
CTTGGAACGGAATGTCTGCGGCGCAGATAGGTTCATCCCATCGTTGTTCCCCAGATGGTTGTAGCTGACAATTGAGGTGGGCTTGATTCCAGCACCAACA
AGGAAATCCACCAAGACAGATTTCATCTTGGTCTGGCCACTCTTGAAATCATCGCCACCAATCAGGCAGTTGTTCTTAATAGCAAGATCGATCAGCCCAG
GCACAAAGGTGTTCTGAGGGCTCCCGTTGATGAATGGCACACCCTCCATGACGCAGGCGATGGCATACAGTGTTGACGGAGATATCTCTGCCTCGTTCTT
GTCCACAGACGCCAAGAGGTTCTCCATCGTGTCATTAAGCCCAACAGAGACGTTGCTGTACCTTTCAGTGTTTGCCGTCCAAAGCACCACTACCTTGTCC
ACCTTGTTCTTCTCCTTGAACTCCCTTATGTCTTTGATAATCTGCTCCATCTGCTCTTTCTTTGTGCCCTTGATGACATTGTTAGCCCGGGAGCCCTGGT
TGGCAGCGATGAAGTCCGGGTCATAGATGCCGGGGAGTGGCACGATGGACTCCATGTAGGGCCTGAGCTGCTTCTGCAGGTCAATGTCCAGCACCTTGGC
CCTGGTCATAGCATCAGCCAGGTTCATGCTGCTAATGTCCCAGCCCCCAAACACAAGGTCATCTGGGTTTACCATGGGCAGGAGGCTCTTGAAGGGCGCA
TAGATCTCCTCTCCGTTGTAGCTCCCGACCCTGATGGTGGAGGCCTGGGTGAGGGACCCAAAGTAGTTGGCCTGCTGCACCTTGTCCTTGGTCGCCCATG
AGATCCCCTCCCTGTTGGCGATGACCCCAGCCATGAGTGTGGAGCCATTGTTGCCGCCCCACCCCACGAGCATCACCCCGAGCTTGGGGACGTTGGTGTT
GGTCTTGAAGTGGTAGTTGACGGACTTGGGGCGGACGACCCACTTGGAGGCGCCGTCGTGGCTCTCGTGCACCAGCTCCGTGGTGTCGTAGCGGTACTCG
GACTCGATCTCCCCCGCGCCGTACCTCACGTTCGGGCTCTCCACGCGGAAGCTCTCGATGAACATCTTGGCGACGCAAGATCGATCTCTCCCTCTCTTTC
TTTCCTGGAGACTCTTGCAGGGAGGAAGAGAGAGGTTTTCGAGTGCGG
page-top