Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2414
Contig Information
Length 1294 bp
Tissue Seed DPA20
Clones 13 Clones [Download: CSV  ,  FASTA ]
whdp1l17    whdp2e14    whdp5h03    whdp6j20    whdp12c22    whdp12d09    whdp13a11    whdp16l11    whdp18b17    rwhdp2e14    rwhdp12c22    rwhdp12d09    rwhdp13a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 4.16559e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2414
CTCCTCCTAAACCACTCTCCCTATCCCCGTGGTCCAGAATCTACCCCCCGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGC
AGGACAAATCGGATATGCTCTTGTTCCCATGATTGCCAGGGGAGTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCT
GCTGAAGCTCTTAAAGGCGTCAAGATGGAGTTGATCGATGCCGCATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTTGAGGCTTGCACTG
GTGTGAATGTTGCGGTTATGGTTGGTGGATTCCCCAGGAAGGAAGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGC
ATCTGCTCTTGAAGCTCATGCAGCCCCCAATTGCAAGGTTTTGGTTGTTGCCAACCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCT
ATCCCTGAGAAGAACATCAGTTGTTTGACCCGCCTAGACCACAACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTGAAGA
ATGCTATTATCTGGGGTAATCACTCGTCCAGTCAGTACCCTGATGTTAACCACGCCACTGTGAAGACTCCCAGTGGAGAGAAGCCTGTCCGTGAACTTGT
TCAAGATGATGAATGGCTAAATGGGGAGTTCATTGCCACTGTCCAGCAGCGTGGTGCCGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCT
GCCAGCTCAGCTTGTGATCACATCCGTGACTGGGTTCTGGGAACCGCCGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGC
CTGCTGGTCTTATCTACTCCTTCCCAGTAACGTGCAGTGGTGGTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGA
TGCGACCGCCCAGGAGCTGTCCGAGGAGAAGGCGCTGGCCTACTCATGCCTCGCGTAAATCCACATTGGAAGGGCAGCTGCTCCTCTGGATGTTTTGAAT
AAATGAAACCTTCCGCTCCTTAGAAACTCTCGTCTCTACCCAGAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCCAGTGTGTATGAA
TGAGGCTTGTAGCTCCCCTTTTGCCTGATGATTTACAGGACAGTACATTTGCTGGAAGAGTGAAACAATTTGACACCTGATTATAAAAAAAAAA
page-top