Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2407
Contig Information
Length 1045 bp
Tissue Seed DPA20
Clones 12 Clones [Download: CSV  ,  FASTA ]
whdp2g02    whdp8i07    whdp11m02    whdp14i06    whdp14j19    whdp20a14    rwhdp2g02    rwhdp8i07    rwhdp11m02    rwhdp14i06    rwhdp14j19    rwhdp20a14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.15433e-117
Total Hit Count 496
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2407
TTTTTTTTTTAGTTTTAAACTCATAACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAACTGAACGCTGGCTAGGAATGTCGACAGAAGTACTCAA
GAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCGACTTCTATTTTCT
ACTCAGCAGCAGCAACCTCCTCCGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCACCGTGCAC
CTCCATGAGCTTCCCCAGGTCAAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGAGGTGGCCTTCTCA
ATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTTGCGGCGGA
TCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTCGTGAAGCCAATGGTGAACATGCGGAGCATGTAGTTGTC
AGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGAAGTTTGTG
AGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATACTTCGAACACCC
TGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGTGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCCTTGATGTC
ATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTTTTGCTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGGTTGCCGCT
GCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGAGCTCGGG
page-top