Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2402
Contig Information
Length 842 bp
Tissue Seed DPA20
Clones 12 Clones [Download: CSV  ,  FASTA ]
whdp10b20    whdp2d06    whdp8a13    whdp8o12    whdp12d24    whdp16b07    rwhdp10b20    rwhdp2d06    rwhdp4g22    rwhdp8a13    rwhdp8o12    rwhdp16b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 843
Evalue 1.93027e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2402
TTTTTTTTTTGCGGATAATTCATAGCGGAGTTCATNTCATTCAAACGGTAAGATAGCAGCAGACACAGGAAGATAACCAAGGCCGCCGGACGCAGATCCA
GCGGCCCAAAGAGTCCACCTAAAACCCTCCTAAACCAACCACGGAGATCTCATCGGACGGACCAGGGGAAGACACGACACACGACTCTCTTATTTAGATC
GACGACACGACACGGGACACACGGGGCGATGACGACGACGGCGACCGGCGGGCGGGCGGATCTAGAGCTGGCCGCAGTCGGCGATGACGACCTGCTTGGA
GCAGGTGCCGCTGCGGGAGCCCACCTTCTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGACCACGTGCTTGCCGTCGAGCCAATTG
CAGGGGACGGTGCAGATGAAGAACTGGGAGCCGTTGGTGTTGGGCCCGGCGTTGGCCATGGAGAGGATCCCGGGCTTGGTGTGCTTGTGGACGAACTTCT
CGTCGGCGAACTTCTCGCCGTAGATGGACTCGCCTCCGGTGCCGTTGCCCCTGGTGAAGTCGCCGCCCTGGCACATGAAGTCGGGGATCACGCGGTGGAA
GGCGCTGCCCTTGTAGTGCAGCGGCTTGCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCAGAGCGCGCGGAAGTTCTCCACCGTCCGCGGCACCGCGTCC
TTGTACAGCTCCATCACGATGCGCCCCGCCGGCGCGCCGCCGACGGTCATGTCGAAGAACACCCTCGGGTTGGCCATCTCGCTCGCCGGGATCGGGGATG
AGGGCTAGGGTTTTGAGATGGGGATTTCTGTGCGGATGGATA
page-top