Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2393
Contig Information
Length 819 bp
Tissue Seed DPA20
Clones 12 Clones [Download: CSV  ,  FASTA ]
whdp1g23    whdp11n05    whdp17o18    whdp20k19    rwhdp1g23    rwhdp1l17    rwhdp5h03    rwhdp6h03    rwhdp6j20    rwhdp11n05    rwhdp17o18    rwhdp20k19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 899
Evalue 5.90009e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2393
TTTTTTTTTTGATGCTTCAAGAGAAAAACAAGTTGATTCTAATCAGGTGTCAAATTGTTTCACTCTTGCAGCAAATGTACTGTCCTGTAAATCATCAGGC
AAAAGGGGAGCTACAAGCCTCATTCATACACACTTGGAAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTC
TAAAGAGCGGAAGGTTTCATTTATTCAAAACATCCAGAGGAGCAGCTGCCCTTCGAATGTGGATTTACGCCAGGCATGAGTAGGCCAACGCCTTCTCCTC
TGACAGCTCCTGGGCGGTCGCATCCATCTTCTTCCTCGAGAACTCATCGATCGGGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTACTGGG
AAGGAGTAGATAAGACCAGCAGGCACACCGTATGAACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTCAGCGGTTCCCAGAACCCAGTCACGGA
TGTGATCACAAGCTGAGCTGGCAGCAGAGAGAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCAGCACCACGCTGCTGGACAGTGGCAATGAACTCCCC
ATTTAGCCATTCATCATCTTGAACAAGTTCACGAACAGGCTTCTCTCCACTGGGAGTCTTCACAGTGGCATGGTTAACATCAGGATACTGACTGGACGAG
TGATTACCCCAGATAATAGCATTCTTAACGTCAGAAACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAAC
AACTGATGTTCTTCTCAGG
page-top