Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig81
Contig Information
Length 531 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl20m09    whfl45l09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glucose-1-phosphate adenylyltransferase large subunit, chloroplastic/amyloplastic; AltName: Full=Alpha-D-glucose-1-phosphate adenyl transferase; AltName: Full=ADP-glucose pyrophosphorylase; AltName: Full=AGPase S; AltName: Full=ADP-glucose synthase; Flags: Precursor >gi|995746|emb|CAA79980.1| ADP-glucose pyrophosphorylase large subunit [Triticum aestivum] >gi|110729318|gb|ABG88200.1| ADP-glucose pyrophosphorylase large subunit [Triticum aestivum]
Score 480
Evalue 8.38851e-47
Total Hit Count 106
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig81
acATCACCACAGCCTCCGAACTCGACGGCTCGACCGTCTCTCCTCTCTCTCTCTCTCTCCCCCTCACCACCACATCAGCGGGGCCACCCCCGGCCTCTTC
TTCCCTGCATTTGATTGATCCGTCGCTTGCCCGGTCGCCCGTCGATCCGTTTACCCGCCGTCCGCCCGTCCCCGGCAGCCGCAGCCGCACCGCAGTTGCA
GGTGGACTGCGAATGTCATCGATGCAGTTCAGCAGCGTGCTGCCCCTGGAGGGCAAAGCGTGCATCTCCCCCGTCAGGAGAGAGGGCTCCGCCTCCGAGC
GCCTCAAGGTCGGGGACAGCAGCAGCATCAGGCACGAGAGGGCCTCCAGGAGGATGTGCAACGGTGGCAGGGGCCCCGCCGCCACCGGCGCGCAGTGCGT
GCTCACCTCCGAcgccagcccagcagacacccttgttctccggacgtccttccgcaggaattacgccgatccgaacgaggtcgcggccgtcatactcggn
ggnggcaccgggactcanctcttccctctca
page-top