Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2386
Contig Information
Length 1035 bp
Tissue Seed DPA20
Clones 11 Clones [Download: CSV  ,  FASTA ]
whdp10c02    whdp5e03    whdp9p14    whdp11o24    rwhdp10c02    rwhdp4c22    rwhdp5e03    rwhdp9p14    rwhdp11o23    rwhdp15k15    rwhdp16f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1182
Evalue 1.32086e-127
Total Hit Count 395
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2386
TTTTTTTTTTAGAAAAACATATACCAGCTCAAGATGACTAAATTGGTCCCAAAACATTCAGTTGCTATATAGTCAAAAACATGAGAAGTCTACGGAAGAT
GACAGGTGACGGCCACGCCCGTGCTTGGACCGGTCCACCACCATAACTGGCCTGAAGAACACACGCAGCATCTACAGATTTCTCAACTGTAAATAAGTCG
GGGTAACCTAAACAGAATTTAATCTCCGGTTACAACCACAACAGCCAGCCAGCCAAGCAGTATTGCGACTGTCTAGAAAGACTCAAGCTGTGCTGTAGCC
ATAACATGCTCCCAATGCTATCATGTATCAATCAAAACCCGAAGAAACCAAGCTCTGTCGCCCTCTCCTTCTCGAAGGTCTCAAAGTACTGGTATATGAT
GGTGACGGCCAACAGAATACCGGTTCCTGAACCAATTGCGCCCATAAAATCAGCAAGAACAGTCAATGCGCCGATGCACACTCCACCAAATGCTGCGGCA
GTAGGGATGTATCTGTTCAGTTCCTTCTGCAGGTTTGACTCACGATGGCCTGGCATCACCATTTGTTGTTCCTTCAGCTGCTTAGCAACATCCTTGGCTG
ATGAACCAGAGACTTCAATCCATGTTTTTGAGAAGAGAGCACATGCTGACAGCATGAAGACCACATAGAACAATGCATGGAATGGATTCGCCAGAATATC
AGCCATACTTGATGGTGCAGTTACATAGTAAGCAAGACCACCAACAGGGATAGAATGGCCAGAATATTCAGATTCTTTCCATATACCGAGAAGGTTAACC
AGAAAGTTTCCACTGTACTTCCTGTAGAGAAGCTGGGATATGAAATACAGGTTGGTAATCAGGGCAGAGTGCAGAATGATGGGCATGTTCGAAGTGTAGA
ACAGCTTAATTGGGTATGAGCCTTGCTGCCCACGAGCATTCTTTGACCTCACTGGAAGCACAACACGGAAGCCTTGGAAATAGATAACTATGAGAAAGAC
CAGGACAGTAGCAAGCAAATTGGTCACATTTGGCA
page-top