Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig2379
Contig Information
Length 1621 bp
Tissue Seed DPA20
Clones 11 Clones [Download: CSV  ,  FASTA ]
whdp10m03    whdp2a11    whdp6e19    whdp15k09    whdp17i05    rwhdp10m03    rwhdp1b24    rwhdp2a11    rwhdp3a05    rwhdp15k09    rwhdp17i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Enolase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1598
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig2379
TTTTTTTTTTAACGCAAGAAAGGCGAAGATGATGCGCCAAAAACTAGTATTACACTTCCAAAAGGTTCAGGCCGAATCAGGTACATATCCACAAGGACCA
AAATTGGAGCAAGTTTGAGGGTACATATCCGTTCCGTTCACATAAAACATGCGCGGCATTCATTATTGCTCAATCCTAAGAGCTTCAACCAGAGTTCATT
CCGGAGGTTAAAACACACCCATTTTCTTCACAAAAACTCATGCAGATCCCCGTTTAGTAGGGCTCCACCGGTGCGCGGAACTTGAGGCCGGCGTACACAG
CGGCATCGCCCAGCTCCTCCTCGATCCTCAGAAGCTGGTTGTACTTGGCAAGACGCTCCGAGCGACAGGGAGCCCCGGTCTTAATCTGACCCGTGGACAA
ACCAACAGCCAAATCAGCAATGAATGTGTCCTCGGTCTCACCACTCCTGTGGCTGGTCATGACACCCCAGCCAGCATGTTTTGACATCTTCACAGCCTCG
ATACTCTCAGTGACGGATCCAATTTGGTTAACCTTCAGCAGAAGAGCATTGCATGACTTCTCCTGGATTGCCTTTGCAACTCTAGTTGGGTTGGTGACTA
GAAGGTCATCACCAACAATCTGAACTTCCACTCCACATTCCTCAGTCATCTTAGCATAGTGCACCCAGTCATCCTGGTCAAATGGGTCCTCAATCGACAC
AATGGGGTACTCGCTCACGAATGACTTGTATACGTTCTTCAGGCTATCTCCAGATATCTTCTGGGAACCATCGTTGTTCTCTTCCTTGAAGTTGAGGTCA
TAGGTTTTGTCCTTGTCATTGTAGAACTCTGAAGCAGCAACATCCATTCCAATGACAACCTTGCCGGTGTATCCAGCCTTCTCAATTGCGGTCTTCAAGA
GCTCAAGGCCCTCCTTGTTCTCCTGAATGTTAGGAGCAAAACCACCTTCATCTCCAACATTGGTGGCATCCTGGCCATACTTCTTCTTGATAACAGACTT
CAAGTTGTGGTACACCTCAACACCCATCTTCATTGCCTCCTTGAATGAGGCAGCTCCAGTAGGAAGGATCATGAACTCCTGCATGGCAAGCTTGTTTCCA
GCATGGGATCCACCATTGATGACATTGAATGCAGGAACAGGCAAAACCAATTGCTTGTTGCCAGCAAGGTTGGCAATGTGCTGGTACAGTGGAATCTTCT
TGACGCTGGCTCCAGCTTTGCAAACAGGCTAGTGACACAGCCAGGATTGCATTAGCACCAAGCTTTTGCTTGCACCAACCCCACTCATTCTTGGTTCCAT
CAAGCTGCTGAACCATAAAGTTGTCGAGCTCAGTTTGAGCGGTAGGGTCCTTGCCGACCAAAGCAGGTGCAATAATGGAGTTCACATTGTTAACAGCCTT
GGAAACACCCTTGCCCAAGTAGTCAGATCCACCGTCCCTCAGCTCCAAAGCTTCATAGACACCAGTTGATGCACCGCTGGGAACAGCGGCCCTGGCGAAG
GTTCCATCTGAGCAGCACACATCAACCTCGACGGTGGGGTTGCCGCGGCTGTCGAAGATCTGGCGGGCCTTCACGGACTGGATCGTCGCCGCCATGGCCG
GAGCTCTGGTCTCGCGTCGCG
page-top