Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd11b01
Contig Information
Length 772 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd11b01   
Homology (BLAST) Top Hit hypothetical protein OsI_01393 [Oryza sativa Indica Group]
Score 175
Evalue 4.74558e-11
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>whvd11b01
AACACCTCGACCCAATCCGTCCTCTCCCCGACCACCGCGCCTCACCACCGTCCCGCCTCGCCGCGCTGTCCACCAGCCACCGCTTTCCCTCCGGCCTCTA
TCGCTCCGCCGCCTGCTGCTACGCCGTCGAACCCCCGCCCCACGATCCTCCAAGCCCCACTCGTCTCCCCTGGCCTCTGCCGCTGCTGTTCCTGACGTCC
CCTGCGGCGGTGACATGACTAGGTCCCACGGCGAGGGCAGGGAGGAGGACCGGCCCGTGGCTTGCGAGACGGGGCCGCGGAAGAAGGCAAGGAAGGGGAA
GCGGGGGAGCGCCAAGGCTCGGCCGCCTCCACCTGCCCCGTCCCAGGAGCACCGCGCCACCACCAGCGACGACGACGGGTCGGCTCAGGTCAGGGCTATG
GTGGCCGAGCAGATGCGGGATATCCTTGCCGTCGACGCCGCTAAGAAGAAGAAAGTTGCCGAGCTACTTAAAGGCCTCTCTGGGGAACGTGACCTTTCTG
TGGAGGATACGTTTGGTGACTCCAATGATGGCAGCCTTGAGAGTCTTCAGGCTCGTAAAGTTGCATTGTTGGTCTCAAAGTCAGTCGTCAGCCTGTCTTC
TTTTGCAGGTGGAAAGAGGATCCGTGTATGTTCGGGATTTGTGATGCATGGAACAGACAATACTGGTGCAAATATGATTTTAACCTCANCAACACTTGTT
ANATCTCTGAATGGANACAGTAATGTGATATCTGATGTGACGGTCAAGGTTCTTCTACCTGATGGGCATATA
page-top