Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd11a22
Contig Information
Length 793 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd11a22   
Homology (BLAST) Top Hit hypothetical protein OsI_37850 [Oryza sativa Indica Group]
Score 905
Evalue 1.11767e-95
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>whvd11a22
GGGCGCCCGCGCTCCTCTCCGCACCGCCCCCTCCCCCACCAATGGAAGAGGATGGTCTCACCTCCCACGTCGCACCAAGCCCAACCACACCCCCACCCCC
GTCAAAGCGCGGTTTCTTGCGTGGGCGGCCGCCCATCAGGGTGACATCGGAGTTCGACAGCGAGCGCCAGCTCTTTTCCCACCGCATCTCCTGCCGCGTC
CTCAACGGCCTTGCCAAGCTCCGTTTCCGAGTTCACCACGGGGCCGCGGGAGGGGCCCCGACTCCCGAGGTGGCGCTCATGGGGCGGAACTTCTCCGCCG
TCGTCGACACCGCCTCCCGCAGCGCCGTGCTGCGAGGAACGGCCGACCTTGCTGGATCGCTCCACCTTAGTGCGGCGCACAACACGAAGGAGGGACAAGG
AGAAGTGGCAGTAACTACTAGTTTGGGAGATTCACCATGCAAAATTGAGTTATCATCGCTGGTTCCTCCTGATGGATTGCCAAGAGCAACCTTCTTGTTT
CCTAACGGGGAAGTTTCAGTTAAGGAGAAGAAGTTGGATGAGGGTGAGAAAATTTTGTCAGTAAATGGTATAGTGAAGTCTCATGTTCTGAATGGAGTTT
GCACTGCATTGTACAATGATAATATGATGAATATCAAGTATCGCTATAAGGATGATGAGCTATCATTTATTCCCAGCCTCACTTTACCATCAAATTCACT
ATCATTTGCATTTAAACGCCAGTTAACTCCTTCAGACAAGTTCAGTTACCGGTACCATTTTGACACGAACTACTGGAAGTGCTGTCTATAAAC
page-top