Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11e12
Contig Information
Length 856 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11e12   
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 774
Evalue 1.9874e-80
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11e12
CTGGTACTGGTAATTGTAAGATGGAATGGCATGAACCAGCATCCACCGATTTACATCACAAAACCCAACAGAACGGAACCTCTGATATCATCATCATCCT
CGTCACACAAGTTCAGGTAAGAAGATACACAGTTGCACCTAATGTACATGCATCAAGCACAGAGGGTGCTCGGTTTCTCGGCCGAAGAGCTCGAAAGGCC
ACCTTAAAACCTCTCCATGGTACCGACCACCGGCTGTGCCTCCACACGCTGCCTCTTCTCAGAAAGATAGGGACCCCTTCTGACCGCCTCATTCAGCTTT
CCAATGAGTTCAGAAAGGCTCGGTTCATGAAGAAGGTGCGATGATGACAAGGCCTTGTTGATTGCCACACAGCAAGCGTACCGTGCCTCCATGCCAAGTT
TTGTTGTCTCCATTTTCGGATCCGTAACAATTCCGATTATCTCTGGCTTTGAGCAAACTTCCCTTAGGCACCATTCTCGGACAACCAGTCCTGACAGTAC
TCTATAACCAGCAATCCGAACGTCTGGATCTTGTTGTAGAATTGATAGAAGAAGAGCCGAAGGAGTTAATTTTGGACTGTTTGATGCTGCACTGTAGACT
AAGCGCTTCAGGAACTCTTCTGCTTGAGGATCATCCAGTTTCATCTGGTCTTCTTGTCGATCAACACCACATATGCTTCCCAAGGCATGTAAAGCGGCCA
GATGTTTACCTCTGCCCTGCCTATCAAAGGACATTTCTACCACATGTCTGGCAATATTTGGTGGATCAGAGAGCAACAAGCATGCTCCTTGAGTTGTTGT
ACCAATTAGTCCTAAGGTCTCCAACGCGCTCTCAATTTCATCAGTATTTTGACTTT
page-top