Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd11a18
Contig Information
Length 869 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd11a18   
Homology (BLAST) Top Hit hypothetical protein [Tetrahymena thermophila SB210] >gi|89294693|gb|EAR92681.1| conserved hypothetical protein [Tetrahymena thermophila SB210]
Score 79
Evalue 7.89651
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whvd11a18
ATCTAAATAGAAGGTGTCCAAGTGGAAGGGTCTTCATGAGCGAAAAAACATCGAAGGGCAAAAACTGTGAAATGTAGAAAATCGTGAAAAAATTGACATC
AAAACGTGTGCAAACACGCATAGAATCGAGAAAATTTAGATAATGACATCCAGCAAAAAACTGTTTAAGCACATGAAAAATATGTTCTAAAACCTACCAA
GTTTGTGATATACGTGAAAAATGAGGTCCTATTGCAAAGATACTCTCAAGCAAAATATTGTTAGGACGTACCAAAAAAGTTCTGTACCAACCCCCATGTA
GTGAGATGAAATTTGAGAAAAAAATGGTATTGCCTGAGAAACATCTCTGGCGTAACGCAGTATATATATTATGTACCAACTCATGTAATCATCGAAAATT
GGGCAAATTATGTACCAACTCAGGAATCAGTTCGACCTTCTTTTTTTTGGTAGAAATAAGCTTGGCCTTTCTTGATTATCTGACATGGAATATCCTTAAC
TAGGCTAACTTTTTAATCTGCCCAATTATTGAGTACATTGGCAATCCCTAAGCAAGCCATTATACAACTCGAATACAGTTGACTATTTAAAATCTATGGA
GATAAATACATAGTATTGTATACGACCTATGAGTAACAATTAAGATACAATGCACTTGCAGTGTCTCACGGTGGGTCGGTACAATCCCATGTTCCCTAGC
ATGTGCGGATGTGCCCATACAATTGGTTAGACATCTGTATTTCAATGACCTCTGAAACATGATCATTAATCAATATGTATGCTGGTTAATTATTTTGTAT
CGTCATATGAGTTCAGACTGGGGACTTATTTGGAAATATTCACTCTTTAGTATTATAAATATGAATACG
page-top