Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11f09
Contig Information
Length 109 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11f09   
Homology (BLAST) Top Hit putative HALF-1 transcription factor [Triticum aestivum]
Score 158
Evalue 1.45494e-09
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11f09
GTTGCTGTTATTATTAGCCTTCTTATGAAGCTNACCCTCATCATCGNGATGCTGCACTTTGGGCGCTGCGATGCTCATGCCCAGTGTGGTTGTGACCGCC
GGCACGAGG
page-top