Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10l11
Contig Information
Length 782 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10l11   
Homology (BLAST) Top Hit hypothetical protein OsJ_028780 [Oryza sativa (japonica cultivar-group)]
Score 464
Evalue 1.49666e-44
Total Hit Count 150
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10l11
ACATACCAACATGGGCGGCGGCGGCGTCACCTAGGGTTGGCCAAGGTTCCAAGCATATGTAAAAGAATACTGTCTAGTATACTTCCGGCTACAAAATGGA
CTTCTGATGATATAGCTTCAAGAAACAATGACACTTCCAAAGACCAGACAATAAAACATTGAGTAATCATGAGTTACACATCTAATCTAAAGTTCAACAG
CAGCATGGCAACGGCGGCAAGGCTCAACCACACGTAGCTTTACCATGGAAGGGACTTTAGGCTCAATGTATGTCCTGATAGCCAAGAGTCCTCGTTGAGC
TTCCCTCAGAACATCAATGGGCAGTGGGAAGCACTTGCGACGTTTGTTAGCAGGCACACAACACCTTGGACGACTCTGATACGACTCCAGCCTAAGGTAT
TCAAGTGATGTTATGCTCTCAAGAAAATGGCAAGTAAGCTCAACAAGACTCTTTGCAGATGTGAATCCTAGGATCTTCACTCTCTTCATCTTGTGATGCT
GCTGTCCTTTCCTCAGATCTGAGGGATCTGTGAATATGGAGACATGCTCCATTTTCTCCTTGGATACATCCAAGACCAGTGTCTCCAAGGAGGGGCAAGC
GCCAAGCAAGGAAACTAGAGAAAAATAATCATAGGAAAAGGCTATTATGTCAAGACTAATAATTAGCTTCTTGAGGTGGAGAAACTTGCTGCGCGGCACT
GGTGTATTGGCCATCTCGCTTCTCGAATCTATATTANCAATTTTGAGGTTTGGCATGCTGGATGGAAGTTCCAACACAAGCC
page-top