Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd11e03
Contig Information
Length 519 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd11e03   
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 237
Evalue 1.21731e-18
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd11e03
GGGTTATGCGCGATTACAAAGGTCGGTCGGTTAATACAAGATAGGCAGGAGCAATCGCCTCTTTGTACAAATGCAGGCGGCTGGCTCCGATGCCTGTGAC
AGGAACTCTATACTAGTCAGGTCATATTAGACATGAACGAGCACGTACAGGGGGAAAAAAGGCAGCAAAATCTTCGAGTAGGTTCCCCTCCATGGAAAAA
ACTCAGCCAGCGCAGTGGCAAGCTATGCGACGGCGACCGCGGGTGCTAGGGCGAGCTCCATCGCCGGCGGTGGCTCGGGCCACGAGAACTCGAACGGGGC
TTCGATGGCGAGGGCTTGAGGCGGCGGGGCAACCTCTGCCGGGACCGCCTCGGTGTAGTGGAACTCGATCTGGAGGCGGTGGTGCAGCGGTGTTGATGCC
ACCGTTCCCCTCTTGATGTCCCCCTGTANCTCCCTGATCNGTATGGNCNCCAANAANCTCTTGATGTACTCTTTGCACNACTCCTTGCCCTTCNACNCNA
NTACNTTCTCCTCNNCNNC
page-top