Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8d23
Contig Information
Length 458 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8d23   
Homology (BLAST) Top Hit hypothetical protein OsI_04661 [Oryza sativa Indica Group]
Score 325
Evalue 6.13126e-29
Total Hit Count 39
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8d23
ATTTACATGCACAGACAACTTATTAGCTAAACCAACCCAAAAGAATTGTTGACCACCTCCAAGGCTCAGAGCCGCAGCCAGGAGGACGGCAACAGAGGAG
GGTTTGTGTTTGTGTGGGGAAGGCCCCAAGCATAGCTACCTATACAAGCTGCTGCTATGCAGGTACGGTGCTATACATATCATGAAGCTTTTCTTCTGTA
TAAATATCTCGGGCTATCTACACAGCTCACGAGCTCGACGACAAGCTCACCGTCGCAGGCGTCGCCGGCGCGGGGTTGCTCTTCGACTGGTTCTTGGCCT
CGCCCCAGTGCCACAGCATGCTCTCCCAGAAGCAGAACTTCTCGAAGCAGGTCTTGAGCCTCGGGTCGGTGATGTTCCGCCGCCAGTGCCCGTCCTCCAG
GTTCGCCTTCTCCGCCTGCCGCCGGTCCCACTCCANCCCTGCCTTCTGCCTCGTCCTC
page-top