Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd19o21
Contig Information
Length 530 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19o21   
Homology (BLAST) Top Hit hypothetical protein OsJ_016624 [Oryza sativa (japonica cultivar-group)]
Score 339
Evalue 1.87745e-30
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd19o21
AAGATAAATTTGTTTGTATGTCACATGGCAACATACCAGACGTTGCGACGGATATAGCAGAATTAGTAAACCCTAAGAAGAGGATGCAACATAAGGAAGG
ATACACAGAGTCATTGACAGATGACAGGGAGGGAGGCTGGCTTTCACCAAACAATAGTTACAATAAGAGCCGGCCTCCAAGATTCATTCCTGGCTTCAGA
TCCTAGATTGACAGGGAAGCTTCTCTGATCTCTACTCGCTGTTTATACCTTCTCGACGCCCGCCCACCCAGACGGGAACCAACCACCCTACGTCGCCACT
GGAGCGAGCCTGACGACATCCCAGGCCACCCTCATCACGCCGCCGTGCCTCGACTGCGCCTCCTGGAACGTCCTCCCGGATGCCTCGGAAGGGTGGGGGA
GCTCCCTCCACTTCTCGACCTTGAGCTCGGTGACGTCGATGATGCAGATGTGGCTCTCCGCCAGGCTCTTCCCCTGCGCCCTGCCCTCGACCTGGAAGAT
CTCNCCCCTGCCGACTTCGCTCCCTTCGNT
page-top