Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd19o24
Contig Information
Length 589 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19o24   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 477
Evalue 2.51823e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd19o24
GCTTTCTGTTACAACTTACAAAGAAGCCCAGCCAATTAAGAAAACTCCTCACAACACCGTGGCAATTAATAAAGTGCATACACCAAGCACGGCGAATCGC
CTGAAAAATGAATTAGCGTAGAAAAGAATACATCACTATATTGGAGACAAATCACGAAGAACTCGCTGGACACGCGAGAGCAAAAGCTTGCGGATAACAA
AGTGAGGCGGTGGCGAAGCAATGAAGCGACCAATCTTCTTCACCGACGATCGATCTTGATAATCACGCCTAGCATTTCGGGAGATCTGCCGGCGGCGGCG
GGAGCTTCTGGTTCGGAAGGCTGCCGTCCAGCACCAGCCACGCCATCTTCAGCCCCCAGCTCATGTGCACCTCCAAATGGCAATGCATGAACCAAACACC
TGGGTTGTCGGCGCGGAAGCGGATGGCGACCCAGCCGCCGGCGGGGACGCCGACGGTGTTGCGCTCGACGGGGTCGACGAGGTTGAACTTGGCCGGGTCC
TTGGCCGGGTCGTANTTCCCNAANCCCTGGCCGACNACNAANAANTTGAANCCNTGCANGTGCANCGNNNGNNTCTCNNNNNCNANGNT
page-top