Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8e18
Contig Information
Length 737 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8e18   
Homology (BLAST) Top Hit importin beta [Plasmodium chabaudi chabaudi] >gi|56520853|emb|CAH80921.1| importin beta, putative [Plasmodium chabaudi chabaudi]
Score 83
Evalue 2.02458
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8e18
AATATCCATCGCTTTGCATTTCATTGCAATCAAGCGTTGACCTAAACCGTTTTTCGNGNGCCAACATAAAAGCAATCAATACAATNGGCATTGATGCACC
ATTATTTAAGTTTGTTCACTACAGAAGGTTCTGAATTATCACATGTCCAAGGCATACACACTTTCGAATAGGATTGAGTTGCAAGGNGAAAATCACTAGT
CCTATTCAGGTCTTTTCGCCACTCCGCATCGACATCAAGTACCACAACTCGATGTTCGTTGAACTGGAGCTAGCACAAGCACGANGTAAGTACCAAATTA
CTAATAGATATATGGCACGNGCCCACACTCCACTGCTGTTACAAGTTACTTCCCTGATGAGNGAATCTGTAACTAGCTAGTTGATACTTGGCAGNACTTT
CTCTTGCTTAAGCAAGACCCTTTCTTCNTTAGGNGAAATCTTTTCAATGACCAAAGAACCAAAAGGCACTTANCCACTGAACACAACGCCGCCGCCACCG
CCTAGCGTTTTCGGATAAAGCAAATCATTTGCTAATGTCANAGGCTCANAGCACNTCTGCACCACGGAAACACAAAAACAACACCTAGCCAGCCTCAATG
AAGTAAATTTTGTCTACGCCATGNGAAATTATTTAAAANANAAGGCTCGGGTTCTTGGATCTGGACCAGCAAGTTCNGGCATCAGTTTCCCTTGGTCGAA
GTAGGTGNAAATTGACCGCGGAACCGCCGCCGTTGCC
page-top