Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd19p01
Contig Information
Length 622 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19p01   
Homology (BLAST) Top Hit hypothetical protein OsI_08580 [Oryza sativa Indica Group]
Score 396
Evalue 7.00731e-37
Total Hit Count 388
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd19p01
AGTGATCCAGAACAAGTATGTACAGAATTACAAACACTGCTAAGAGAACTCGATTAGTCATTGTACATAGTACACGCAAGTACATGTTTTTTTACATGCT
GAGAAATTAGTACACCACTACTGTGAACAAGGACACGTACAGTTGGTACCTGGTCGCATATGTACAGAATACAACACCTTGTTACTCCCTGCCTGCTTCC
TTCGATTATTTTCCATTTCCACAGATGGACTGTGCACTTCCGAGGTTTTGGCTACGTCTATCATTCTTTTGCATTTTGCATCCCCTGTATGTATCAATGA
GCCAATCTGATCAATTACCCTGAGAACTACTACGTCCTCACTTCCACTATATCTCCATCCTTGAGCTCGGTTTGAGGCAGCACAAGTTGGCCATTCACCC
AAAGCAGCTTCCCATCCACACCCATTCTTCTACCGGCGTCAGCAGCTGTGCTGCCAGTACTCATCCTCATTATCTTCCCATACGGCCAGCAGATGATGGC
CACCTCACGAAGAATTGGATCGGTCAGCGAGCCGAGACTTCTCTCCGCTACCGATGCTCGACGGCGTACTTGCTCCTCCCATTGAAGCATTGTCCTGAGC
CAAATGGACCTTGTTGTTGATG
page-top