Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd19p11
Contig Information
Length 337 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19p11   
Homology (BLAST) Top Hit putative protein [Arabidopsis thaliana] >gi|7270819|emb|CAB80500.1| putative protein [Arabidopsis thaliana] (no hit)
Score 495
Evalue 3.50866e-48
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd19p11
CTACCTTCCGACGGAAGACAACTTCAGAGATTTCATTCGCTTCCCGNTGCTGANNAACTCTGAGACTCNGCCTGAACATGTTGAGAATAACGATGCAGCA
GGTGCCGCTGCTCAAGATCTGACCGAAGTTGAGATAGACGGCGTCCTCACCGGCGAGGCATATCATGGATTGGCCGACCACGGTGACATGAGCGATGCTG
AGGAAGATGCCCGCACTCCGGTGGACTCCCACACCACCGACACCGAAGAAGAANAAGAGGTCAATAATATCTCANAGCAGCGACCGCCGGCGAGTGTCNA
TCGTANCAANAAACCATCANACATGCCGGTGGNCGAC
page-top