Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10m02
Contig Information
Length 644 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10m02   
Homology (BLAST) Top Hit Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|75123464|sp|Q6H7P8|SAP4_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 4; Short=OsSAP4 >gi|49388120|dbj|BAD25251.1| putative zinc-finger protein [Oryza sativa Japonica Group] >gi|113535717|dbj|BAF08100.1| Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|125538468|gb|EAY84863.1| hypothetical protein OsI_06227 [Oryza sativa Indica Group] >gi|125581153|gb|EAZ22084.1| hypothetical protein OsJ_005567 [Oryza sativa (japonica cultivar-group)] >gi|215692751|dbj|BAG88171.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695215|dbj|BAG90406.1| unnamed protein product [Oryza sativa Japonica Group]
Score 450
Evalue 4.23469e-43
Total Hit Count 360
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10m02
TTTACACACATGGGACAATAGTACATAACAGAGCTAGCTAAAATGAGAAGCCACAATACTGACCGAAAAAACCACCATGAATAAAGTTACACAACACGCA
AACCACAATACTGAGGATTGAGTTCTTGCAGCCGCCACGACGCAGTGTGCATCACGATGCCGTACAATTTAGGAAATGCGGCAGCCAACAAGAAAGGGAG
GTGCAAGGATGGCACAGCAAAGACGGATGATGAACCTTGGCAGATTGCAACCATTTCTTCCCTGTAGGACACCTAAATCTTGTCGAGCTTCTCTGCCTTC
ACCACCGGGTTGGCCTTGGCGATGGCATCCCTAGCTGCAGTCCGGTAGTCGAACTGGCAGTCATGCTTGTCGGAATAGCGATGCAGTGAACAGTACATGT
TACCGCATCGGCAGTTGAATCCCGTCAGCCCAACCCTCTTCCTGCAAGTTGAGCACCGATTCGGCCCCTCCTTCCTCTTGGGGCTCACGGCAACAGCTTC
GCTGGTGCCTGCAACATCAGCAGCAGGCTGCACAACAAGCGCCTTCACGTCAACTTGAGCAACCGCCACCTCTGCGCTCGCGGCCACAGCCGCAACAACA
GGTGCTTTCCCACCATCGCCACCGTTGACGATGCTATCGAAGGA
page-top