Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd8g04
Contig Information
Length 684 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd8g04   
Homology (BLAST) Top Hit GA10035 [Drosophila pseudoobscura pseudoobscura] >gi|198136277|gb|EAL25547.2| GA10035 [Drosophila pseudoobscura pseudoobscura]
Score 78
Evalue 6.57684
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whvd8g04
AGGCCGGCGTGGTGGTGCGCCTCCCCACCCATCCATATATCCATCACCAGGCGCCGCTCACCACCAGCGCCCATCTCGCCTGCCATACCCGCGCGCCTCC
ACCTGCTGCTGATTCTCCTTGCCGCTCCCTTCGCCTACCTCGCTGTTGTTCTTCTTCCCGACGTCCTCCATGCTGCCCTTCTGCTTCTCCTCTGCTTCCC
CTCTCCTAGCGCCTCAACTAGCTGCTTCTTCTTCCCCAAACTTTGCTGCTGCTTCTTCCCTCTCCTCACGTCCCTGCTGCTGCACTTCTCCTCCTAACCT
TGCTGCTGTTCATCTCTGAACCCCCAACATGCTGCTGCTCCTCTCCAACAACGACGCCGATCTGCAGCACTCCCTCGTCACCAGCCTCAAGAAACGGAGC
TGCTGATCCTCTCCAACGACCCCTTGTTGATCCTCTCCCACTTGGCTTCGCTGATCATCTTCGTCCCTGCTGCTCTCCTTCGCCCGCAACATCTACAGCC
CAGGAGACAACTCTGAATCTCTCTTCTCTTACTGTAGTTTTCTGAATTTTTGCTCTGGTTATTCTGCAGCTTGTAGTCTGAATCTCAGTTAACTGTTGAT
GTGCCCGTGAGAAAACTAGGTGGTTCAACTTGTAATATTGTTCTGCTGCCTGTGATGTTTGAGATAGTTACATCAAAAAAAAAA
page-top