Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10n17
Contig Information
Length 817 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10n17   
Homology (BLAST) Top Hit hypothetical protein OsJ_034570 [Oryza sativa (japonica cultivar-group)]
Score 1155
Evalue 1.21018e-124
Total Hit Count 171
Registered year 2003
Contig Sequence     [ Download ]
>whvd10n17
CAGAAGTCATGCTGAAGAGGTTATTAAATCGGTGAAGACTGTTCAAAAAGGAGTCACCGAAAGAGCTAGGAGAGCGAGCTTGGTTAGTCAGGAAAGGCTT
CAACTATGTGACGGAATGAGCAGGGATAGGATTCAGTTTCCTGATTTGTGGATACGGCCATCGTTTGGTGGCCGTGGGCGGAAGGTCGCTGGAACTTTGG
TGGCCCATGTCAATGGTTTTCAATATTCTGCATCGAAAACTGAAAAGGTGGATATTATGTTCAGCAACATAAAACATGCCTTCTTCCAGCCAGCTGAGAG
AGACATGATAACGCTGCTCCACTTCCATCTGTACAATGAAATCATGGTGGGCAACAAGAAGACTAGAGATGTGCAGTTCTACACTGAAGTGATGGATGTT
GTGGACGCGGTTGGTCTTAAGCGCCATTCAGCACGGGACCCTGATGAGATTGAGGAAGAGCAGCGTGATAGGGCACGAAGGAAGAAAATAAATGGACAGT
TTGAGCTGTTTGTGAAAAGGGTTGTTTCCGTTTGGTCGCAGCCAAGATTTCAGCAGCTCGGCTTACATTTTGAAAGGCCATCACAGAAGCTTGGCTTCAA
TGGAGTCCATGGCAGAACAACTTGTTTTATAGTTCCTACTCCTAGTTGCCTGGTACAGCTTGTTGAGTCACCGTTTCTTGTGACTTCGTTGAGGGAGGTC
GAGATAGTATGCTTGGAAAGGGTGGCCCTGGGGCAGAAATCCTTCGACATGGTGTTTGTATTTCAAGATTTAAAGCGAGATGTTGTCCGCATANAGGTCA
TTCCAAATGGCATCTCT
page-top