Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd19p18
Contig Information
Length 483 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd19p18   
Homology (BLAST) Top Hit 60S ribosomal protein L24 >gi|1154859|emb|CAA63960.1| L24 ribosomal protein [Hordeum vulgare subsp. vulgare]
Score 321
Evalue 1.7682e-28
Total Hit Count 213
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd19p18
AGATAAGGTGCAAATTCAAGAGGGCGGGGTAATAACTTGACAAAGGTCTATGATANTAGGATAGGAAACAAGGCTAGGCAGCACAACTCTATGTCTATTG
GNGATAATCGACTTTCAACGCANTTTCAACGCTTCCCGCCGCCNCCGCCAATCTTTGAGGCCCTTGGAACCCTTCTGCACGGCGCCCTTGCNCCCCTGTG
ACTTCTGGGACTTGGTCACCTCTGCCTTCTTGGCCTTCTTCTCATCCTTGGTCTTCTTGATCCGCTCCTTGATCTCACGGAGAGCGGCTTCTCGGGCAGC
ATCACGGACTTCANGCTTCTCANCCCTCTTCTTCTGGATAACTTCCAGAGTGGCACCAACAATCNACCGTGAGTACGGCTTCTTGGTGGTGCGGCGCCTC
TTCTTGGCAGCCTCAGCATGGATGTCCTTCTTGTGCTGCTTCCTGTACATTGCTGTCCAGNAAAGCTTTGCAGGCTTGAGGCG
page-top