Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd8f22
Contig Information
Length 780 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd8f22   
Homology (BLAST) Top Hit aconitate hydratase, cytoplasmic [Zea mays]
Score 926
Evalue 3.97884e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whvd8f22
GTCATCTTGAGTATCTTTCCGGGTTGTCTTCAAAGCAGATGGTGTCTTGTACCCTGACAGCGTGGTTGGCACTGATTCACACACCACAATGATTAATAGT
CTCGGTGTTGCAGGTTGGGGAGTGGGTGGTATCGAAGCAATGGCCGCAATGCTTGGGCAGCCAATGAGCATGGTTTTACCAGGTGTGGTTGGATTCAAGC
TGACCGGAAAGTTACAGGATGGTGTCACTACTACAGACCTTGCCCTTACTTTGACCCAAATGCTAAGGAAGCATGGTGTTGTTGGCAAATTTATTGAATT
TTTTTACGGTGAGGGTGTGGGCAGCATCCCTTTGCCTGCTAGAGCCACAATCGCAAACATGACTCCGGAATATGGCGCTACCATGGGATTTTTCCCTGTA
GATCAAGTGGCATTAGATTACCTCAGACTAATAGGGCGAAGTGATGAAACAGTATCAATGATTGAAGCATATTTGCGAGCTAACAAGATGTTTGTAGACT
GCAATGAGCTTCAAACGGGACCAGTTTACTCTTCAGATCTTGAGCTGGACCTTACTACGGTGGAGCCTTCTGTTGCCGGCCCAAAGAGGCCTCATGACCG
GGTTCCTTTGAAGGAGATGAAATCTGATTGGCATACTTGCCTGGGCAATGAGGTTGGTTTCAAGGTGAAGCCATGGGTTAAGACAAGCCTGGCCCCTGGA
TCTTTGGTTGTCACCCAAATACTTGGAACACAGTGGCCTTCAAGAATATTTGAACCATCAAGGCTTCCATCTTGTCGGAT
page-top