Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10n04
Contig Information
Length 796 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10n04   
Homology (BLAST) Top Hit hypothetical protein OsI_12908 [Oryza sativa Indica Group]
Score 1240
Evalue 1.61966e-134
Total Hit Count 271
Registered year 2003
Contig Sequence     [ Download ]
>whvd10n04
TGATTCTCAGCCTTTCCTCGACCACGATATGTTTGCTATCATGTCCGGCCCTACTATTGCTGCCATTGCAGTGGTATTTGATCATTCGGAACATGAAGAA
GTTCTGTTGACCTGTGTGGATGGCTTCTTGGGCATCGCAAAGATCTCAGCATTTCATCATCTTGAAGACGTTTTGGACGATCTTGTTGTTTCTCTCTGCA
AATTCACCACTCTTTTGAATACCTCTTTGGTCGAGGAACCAGTCACCGCCTTTGGAGATGATCTGAAGGCTAGATTGGCAACTGAGACACTGTTTACCAT
AGCTAATAGATATGGGCATTACATACGTACTGGCTGGAGGAATGTATTGGATTGCATCCTGAGACTGCATAAGCTAGGGCTTCTTCCTGCCCGTGTTGCT
AGTGATGCGGCTGATGATTCAGAAGTTTGTGCTGAAACTGTCCAAGGAAAGCCTGTTCCTAGCTCAATCTCCACATCTCACATTCCAGTGATGGGCACCC
CTCGGAAATCCTCTGGACTCATGGGAAGATTTAGTCAGCTACTCTCGCTTGACAGCGAGGAACCAAGATCACAACCAACCGAGCAGCAACTTGCTGCCCA
CCAGAGGACTCTTCAGACAATCCAGAAGTGCCGCATTGATGGTATATTTACAGAGAGCAAAGTTTTGCATCCTGATTCACTATTGCAGCTTGCCAGGGCA
CTGATATGGGCCGCAGGGCGGCCTCAAAAGGTTGCCAGCTCGCCAGACGACGAAGACACAGCAGTATTCTGCTTGGAACTTCTCATTGCCATCACG
page-top