Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd20a24
Contig Information
Length 601 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd20a24   
Homology (BLAST) Top Hit Os12g0541500 [Oryza sativa (japonica cultivar-group)] >gi|77556660|gb|ABA99456.1| Elongation factor TS family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649463|dbj|BAF29975.1| Os12g0541500 [Oryza sativa (japonica cultivar-group)] >gi|125536917|gb|EAY83405.1| hypothetical protein OsI_38621 [Oryza sativa Indica Group] >gi|125579622|gb|EAZ20768.1| hypothetical protein OsJ_034977 [Oryza sativa (japonica cultivar-group)]
Score 557
Evalue 1.55746e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd20a24
CTCTCCTCTCATCTACATTGAAGGTGTGCAAAAAAGTGTGTTGTTTGTAACCAGGAACAATGGTAACAAGTGATACAAAATTATACATGGAACTCAGGTA
CAAACTANCAGCAGCTATGCACCACGATGAATCAAAATGTGCCCGACTCCTGATGCCATGGATTGTAACGGAGGTCACTGTCTCATTTATCAGTTCTCGC
CGAGGGTATACCTGACAAACCTCCGTACCTTGATGTTCTCCCCCAGGCCGGCGATCGTCTCCTTAACGAGATCCTTCACCGTCTTGCTGTCATCCTTGAT
GAAGGGCTGCTCCAGGAGGGCCATCACTCCAAGCCTCTTTGATATCCGCCCTTCCACAATCTTCTCCCTGATGTTTTCGGGTTTCGACTGCAGGTCCTCC
CTCTGCATCTCAATCTCCTTCTCCTTGCTGACAACACTCTCTGGTATGTCCTCCATTGAGACATATTCAACCTGTGGGCATGCCACCACTTGCATTGCGA
GGTCATTCACCAGCTCCTTGAATTTCTCATTGCNAGCCACNAAGTCAGTCTCAGNAGNTGATTTCAATCATGCATCCTATGCNGNTGTCGTGGATGCATG
A
page-top