Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd8f17
Contig Information
Length 680 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd8f17   
Homology (BLAST) Top Hit hypothetical protein OsJ_028197 [Oryza sativa (japonica cultivar-group)]
Score 171
Evalue 1.07041e-10
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd8f17
CCGTCTGTCGGCTATATTTTTAAGTTAACAGTTGGGACCGACATGCACGGTCCAAATGGCTTTCTTACTTTATACACACCACTCACCGAGACTCCCTGGC
CAACGCCAACCCTAACAGAATCCGGAAGCACAAACTGGGACACGTCTCAGAACGTTACACTCAGGGCAATGACGTAAAGTACGTAAATAACATGGCTCTG
CAGTGGCAGCAAACCATAACTCCTTTGGTGATTCGCGCAAGCCAGCAATCCGATGTCGCCGCAGCCGCCAGCCGGTCGCTCTTTGGCGGACATCTTCAAG
GTTGTGGTTCGTGCTGGGGCGTGGCAGGAGAATCTGGTGCTATGGTGAAATGCACTCCTCTTCCTTGTCCAGACTGAAGGATGAATGCCACCTCAGTTGC
TGCCAACGCAGCTGCCTCCTGAACATAAGTACCGTACAAAACACCGAGCAAGTTAGTGGTTACAAAAGGCTCAAACACGAATTATGATTTGTCGGAAGAT
CCCTTGCATACTGCTTTGATTAGAGCATTTCGAAGTTGATGTCTTTTTATAATCTAAACAGCTCCCAAAGTAGTTGAATGCAAAGAAAATGAGTACAGCC
ACTGAAATCCTTTTACNGTGTTGACGAGATTCATTACTCAGACATCAATGTCATAACTATGTTCATCACTTCTTTGACAA
page-top