Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhvd10m12
Contig Information
Length 666 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhvd10m12   
Homology (BLAST) Top Hit hypothetical protein OsJ_004151 [Oryza sativa (japonica cultivar-group)]
Score 226
Evalue 4.2531e-17
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>rwhvd10m12
CAGATACATACATCATCTTTACAATACAAAAACTTGTTAACATCCTCCCAACAGCAGATAACTTGTATATCACGCCCAAAATGAAATAACAGAAATCAGC
CACCAACATCTGGTGGTCTGAAAATAAATGCTAGTGTACAACACGCCCCTTACAATCTTTGCTGCTGCTTCTGCTGCTGTCTTGGAGCATTGGAGATCAC
CAGAATTTGCAAATTGGATGTGTCTACTCCAGTATCTGGTGATATGGCAATAATTTATAGTATACAACACTTCCCCCTAGGTAATTTTTATACCACGATC
AAGAAGCTTGAAGATCACCAGACTTTGCAAATGCTGTGTCTATTCCTATGCCTGATTTAAGTCAAGGTAAGTTCTAGTAAGGAGTGACAGCAAAGCCAGG
GCTAGAACCAAAGAGGAGGCGAGCCTAGTAGCGGCCCTGACCTGGTGGTCTCCTGTTTGAAGTCCTATCTAAGTTGCTGTAGCGGTTCTGTGACTGCTGC
GGTCGTGAATTAGGTCTAGCAGCAGGCGCCCCACCTCCAGAATAGGAACTATGAGGTGGTTGCTGCTGCCACTGTTGGGCTCCTGCATATGGTGCANGCT
GGTANACCCCACCANCATANCCCCCANCATACGAGGGGGGNTGCCCATATCNNCCAAANCNCNATG
page-top