Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whvd10m12
Contig Information
Length 784 bp
Tissue Shoot grown with dessication
Clones 1 Clones [Download: CSV  ,  FASTA ]
whvd10m12   
Homology (BLAST) Top Hit hypothetical protein OsJ_004151 [Oryza sativa (japonica cultivar-group)]
Score 830
Evalue 5.43249e-87
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>whvd10m12
CTCCTCTGCCCCTCTTTCCGCCCCGACCCCGTCCGCTCGTCCGTTTATAGGGTTAGGGTTCCGGCGAGCAGCTCTGCCTCCCGCCGCCGGCGGCCATGGG
TGTCCCGGCGTTCTACCGCTGGCTCGCGGAGAAGTACCCGATGGTGGTGGTGGACGTGGTGGAGGAGGAGCCCGTGGAGATCGAGGGCGTCCAGGTCCCC
GTCGACACCTCCAAGCCCAACCCCAACGGCCTCGAGTTCGACAACCTCTACCTCGACATGAACGGGATTATTCACCCCTGCTTCCACCCCGAGGACAGGC
CCTCGCCGACAACATTCGCTGAGGTTTTCCAGTGCATGTTTGATTACATAGATAGGCTCTTTATCATGGTTCGCCCTCGGAAGCTTATGTACATGGCCAT
TGATGGTGTGGCTCCTCGTGCTAAGATGAACCAGCAGCGCTCTAGACGATTCAGAGCTGCAAAAGATGCTGCTGATGCGGCTGAAGAGGAAGAAAAACTG
CGTGAAGAGTTTGAGAGGGAAGGAAGAAAGCTTCCTCCAAAACTGCAATCACAAACATGTGATTCTAATGTTATTACTCCCGGCACAGAGTTTATGGCTG
TTCTATCAGTTGCTTTGCAGTACTACATCCACCGCAGATTGAATTATGATCCTGGATGGAAACAAATTAAAGTTATTCTTTCTGATGCCAATGTTCCTGG
TGAAGGGGAACATAAAATCATGTCCTATATTCGTGGCAATAGGAACCTTGATGGATTTAACCCCAAATACCCGACATTGCCTGT
page-top